Description :
From Genome Similarity Track
Location :
Scaffold_1904:283- 3044
Sequence
2761 bases(100 bases per row)
GACTGTCCGGATCAAAATTCAACAAGCTCTGGCCCTGGAGATGTCGGATTCACGAAGGGATCCAAGTAGTACGACGCCAGAAGAGGACCTAAATCAGGAG
CTGGATCCGCCCCGGCACCACAGTATAGAGGATCCAATCAGGATAGAGACGACGGATCAGAACTCGGAGGAGGTGGAGCATCATTGGATCCGAGCTCAAC
ACGCATTCGTGGAGTTGAGGAACAGGATCGCGACCACGCCTATCCTCCGTCATTTCAATCCAGAACGTCAGCCTACGGTAATAGTTTATACCAGCGACTG
GGCAGTCTCAGCAGCTCTGGTACAAGAACATGAGGGGATCTGTCATCCAGTCACCTTCGTCAGCCAGACACTGAAGCCGAATAAACTGAACTACGGAGCG
GTGGAGAAAGAGATACTCGCGCTCCTGCGCGTATTGGATCTGAATTACAACCTGCTGGTGGGAAGATCCATCCGGATCCTGACCCGACACTCTACGCTAG
CCTGGCTGTTCAAGTCGGCCCGCGTTATAAAGAGAACTTTGGGGAAAATGGGCAGCTTTTACTCTCGCTCTGGAAACCTGGAGAATGGTGAAATGTTTCC
AAGGGGAAAAACACATTCTGGGGAATTCTGGGCCGCCAGCCTCACACCCCCAGCTAGATGAGAGCGCTGACTAGGTCGCTCAAGAAAGAGCCCAAACCCG
GATCCAGATCCCGATCCGACGGTACAGGCAGACGAGGATCTGTACTCCTGAGTTTGATGGATCCGCTCGCGTACGACGCGGAGGCGGGGCGTACAGTGCA
ATACTGTGGAGACTACCTGGATGGGAAGTAGTACGGGCCAGATCCACTTATGCGGAAGGCCTCACCGTCAACGAAGCGGAGTATAACGGACTACTGCTGG
GTTTGGATCTACTAAAGGGACAAGATCCGAAAAGGCTGGTGATTTGTGGGGATTCAAATTTGGTGATCAGACAGGTGCGAGGTGAGATTGACTGCAAGGC
CCCGGCTCTAACACTGTTACGGCAGAAAGTGATGATCCACCTGCGTGGTTGGATGAATCACGAGTTGGTGCATGTCAAGCGAGATTGGAATGCCAGTGCA
GATAGCTTGGCCAGCGCCGCTTTACGAAAATCAATGTGGTGTTGAAGTGGAGAGAGAGGCCGAGCATCAGGATCTCGTTACGCTGAACCGACTAGACGAA
GTGGTGGTAGTGAGGTCCGGGAAAAGGACAGTCCAGGTGATGGCCGTCCACTATGCACCAGAGGAAGGATTGGATCCAACCCCAAAATTCTCGAGGAAAC
ATTTGTGAAGAGAGTCCGCATCGAGCGGATCCTCAAAGCACAGAACGAGGAAGCGTGGATCCTAGGACTAAAGAAGTATCTGATGGGGGATGTACGAGAC
CTGAGTCGGGAAGATGCCAAATCCTACAGCATTATCGCTACGGATTACGCGGTGGTCCTGCATGACTTGCTCTTCTATTGCCCCCTACGAAGAGAGTCAA
CGAGGATTGGGATGGATTGATGAGACTGGTGATGCCGGAAACCTTACAACAGGATGTCATACACCACTATCACGCTAGCTTGGAAGGCGGACATCAGGGT
ATTGGTCGGACCTACCAACGGATCCGGGAATGTTTTCACTGGAGGGGACTATTCAAGAGCGTACAACGGTATGTCGGGGAATGTGTGGATTGTGAGACAG
GCAAGGGCAGGCCCACAATCGAAGGGGAGTCACCTGGGAATATCCAAGCGACTTACCTTTTCCATATCATAGCCATGGGTCATATCCCCTCGTTGCCCAA
GTCGTTCAAAGGAAACACAGAATTGTTGATTTGGGTGGACCTGTTTACCGGGTACGTGATAGCCAAAGCTAGTGCGTCTAGAACGGCGCAAACCATTGCT
GAATCGTACGAGGAGTGTGTTTTCCGAAGATTTGGAGCTAGCGAAATGATTAGACATGATCGGGAGCCAGGCTTTATGTCTGATTTCTTTCGAGCATTCA
ACCGGATCCTGGGGCAGCGACAGCGAGCAACCATGGCATATCGTCCCCAAGCTAACGGGTCGGCCGAGCGCATGGTGCAGACGATCACGAGAGCACTCAA
GATGTATGTCCAGGATTTGGATCAGAGGGATTGGGATGAGTACGCAGAACGACTCCCCTTCGCGATAAACACCGCCCAAGACAGGATCCGGGGTGATACC
CCGTTTTACTTGGTACATGGGTGGGATCTCAAATCCACCATGGAAGCGGCCATCCCAGTATGCAGCACCAAGAAGAGAAACCGAGATCCAAGGCGATGGC
GATACCAAGTCCAGAAATACTACCGGCAAGCTAGATCCCAGGTGAACGAACGACTGCGGAGTGCGATACAGGATCGAGCGGATCGACACAACGAAGACGC
CCGTCCACATCAAATCCAAGTGGGATCGCAGGTGTGGCTTTATTTGGATCGAGTGAAAGAAGGGTACGCCCGCAAATTGGCCCATCTATGGCATGGACCG
TTCCGGGTGAGCGAGAAGATTGGAGAACACGCGGTAAAGCTGGAAACGGCAGGTACCGAAAACCGCCTGTTCCCTGTAGTACACGTATCCAAGCTGAAGT
TGGTCAAAGAATATCCGGATCGGCCGCAGATCCGTCTTTCGGTGGATGGATCCGATCGCGTCGACTTCGACGAAGTCCTCCTACCGGAAGATAGTTGGAA
TGTGGATCTCAAAGCCGACGAGTTCGAAGTCGAGAAGATCACCGATATGAGGTCGGGGAAG