Description :
From Genome Similarity Track
Location :
Scaffold_136:283- 2666
Transcript NameFunction/comments
Phyke_g4793reverse transcriptase

Sequence
2383 bases(100 bases per row)
taGACCCGGCGCGAATGCAACTGTTCCACGCGCACACATTCACCAGGAAAGCAGCGATTCAAATCGATCTCTAAGAGGAGTACAGCCATAAGCAGGCTCA
CACCCATGCAGGCGCCTATAAACAATGAACTGGTGACAATGGATTTGAGCACGGCCGAGCAGAGTGATATCCACTATTTTGGATGCAAAAAATTGGGGCA
CATGCAACGTGCCTGTCCTGCGGGAGGACATGGAAGTCGATCCTTCCAGAGACCCCAGGGTTGATCCCAGGGTCCGAAGGGCCGCTGATAGAAGCCGTGA
CCTAGGGGACAGGGGAATACAGGACACCAGTAGGGGCGGGGATTCATACTAGTGAAGACCGGAGTCATCACGACGGGTACGCGGGTGGCGCGCACAATGA
TGGCTTAGTCCCGGAGAGACTGTGTTCTCTCCACACGGAGGAGGGCGGTGGAGGCCTGCTAGTGGTACACATGAGTGTACAGGGATACAATCACCCCTTG
AGAGTGTTGATCGACCCTGGAGCCTTGAAGAACTTTGCTCGACGGCAATGCGTTGCGAGCAATAGTAACAAGTTCTCTGATGCTCTACGCGAGCGTGAAG
GGAACGGACTGGTCTAAGTAAGGCTAGCCGATGGTACAGTGGTAAGAGTACCGAAGGTTCGTGTGAACCTAGTTGTCAAGTTCGAGGACTTTGACAGCGT
CGAGCCGTTCATGGCCCTTGACATGGACAAGTATGACTTGATTCTGGGCATGCCGTGGCTTGAGGAGCACGAACCCTGGATAGACTGGCGTGGAAAAGCC
ATAGGAGCGAGTAAGACTCTGGTCTCTGACAGAGCTTTGATAAGTCATGTTCCCACCTCTACCAGATGACATGGCATTCGTAAGGATGGATGAGACGTAC
ATGGGCGTTGTCGAGGCAGTTGCCGACAGCAGAGAAGTAGTTGCAGTGGGCGCTGCAACAGGTCGCAAGACCTCGTCTATCGTGAGATTTGTTCACGGGC
CATCAGAGGCTAGGTCGATGGACGGGACTTCTAGCCATGCGTACGAAGCGTAAGGCCATAAGATCAAGACTCAGAAAGAGTCCGAGGCGGAGACTACCAC
GTCGGTAGATCTCTGCATTCAATGCCATCGCGCCGCACAAGCTTCAACAGTGACCGTACCGACGGACACGCGTCAAGTGGGTAGCATAGTCCCACACAGT
GCGAGTAATACAGTTCCGCATGGAGTTCCGTGAACTCCTAAGGCTGGCGCCATGGCAGTGTCATCGGGCGTAAGTAACAGAGTACCACGTCCCgaaaagc
agcacaagacTGCGAAGGGTCTGGTGGAATACCAGCCCAATATCGATGCAATCGATCTGGAGCCCTTAGCCCAGGCTCCATCAACACGACCAGTCGAGGA
GTGTCATCACATTCTTGATGGAGTGACAGTTCTACGTGTCAAGGCAGAAGGTGCCACTTGGAGCCACTGCCCGAGGTGTCAGGGTCGTTGAACCTCGAGA
AGTTGTCgttcaacaacttcttggCGGATCTCGGAGTTGGTGCTCATACGTTCTGAGCCCACTCCTGAAGAGGTGAATTCTTCCTCTGTCATGGACAAGG
ACATCCTGGAAGAGATTCGCAAGCGGCACGCTCTGGTTCTGAGATGATCAAGAATCCGAAGGATCCTGTATATCCTTTGCTGAAGGAATTCGGAGACATA
GTATCGAAGAATCCACCGTCCCGACTCCCTCCAGATCGAGGGGTCCGGTATGCGATCGACCTCGTGCCTGGCATCAAGTATTGTGTCACGCGACAGTGAC
CACTGTCACGTGAACAGTGCGAGGTCGTTGATGCCTTCTTTACCGCGAAGGCAAAGGCAGGTATGGTACGGGAGTCTAAGTCCCCACACTCGACGCCTAC
CTTTTGTGTTCGTAAACCGAACGGAAAGTGGCGTCTTACAGCAAGCTGAACAGTGCGACGGTACCGACTCAGACGCCCATATCTCGCAAGGATACTCTCT
CGAACAACATGGCAGGCTGTACGCTGTTCAGTGCCTTGGATCTATTGGATGGGTACTATCAGATCCTAATGCGCGAAAGTGACATTCCGCCCACAGCAGT
GAGCACTCCAAGCAGTATGTTTTGGGAGTGGCTCGTGGTGCCACAAGGGCTATCAAATGCTCCGACGATGTCCAATCGCCTGGTCACACGGTTGTTCCGG
CCTTTGTGTGCGTTCACGCAGACGTACTTTAACGATATCTTCGTTCACAGCCGTGCCGAAGGGAGCAAGACGGCTATTGAGGTGCAGTTGCAGTATCTCC
GTCAAGTGTTGGAGGTTATGAGAGTCAATAAGCTCTATGCCAACATTGACAAGTGCGCCTTTGTGACAGAGGAAATCAAATTT