Description :
From Genome Similarity Track
Location :
Scaffold_2967:283- 1919
Sequence
1636 bases(100 bases per row)
GGAGACCCCCTACCTGTACCACGTGGAGGACTAAAAGCTCTTCGACCCCCCCAAAGTCATTGCAATGTCATCCGACGAAGCGACTTGTGTAAATTGGTGT
ACGGAGGTAGGTTTAATAGACAAGAGAAAGCTATGTCCAAGTTGCGGACGCGACATGAGGCTGTCGGTGGCGTGCAAGCTCTGGAGGTGCTCCCGTCGTG
TGGACCACGGGAACGGGTAGGAAGTGTCCCGTGGGATGCTCTCAAGTTCGTTCTTTAGCGAGTCTAGGATAAAGCTACATCGCGCTgtgcacctgctgct
cgcaTGGAGCATGAGGCTCTCCCAAGTGCAAGCAAGCGAGATGGCCGAGGTCTGCGAGCGTACAGTAAGAGACTGGTACGCCTACTGTCGCGCTACATGC
TCCAAGGAGCTACTTAAAGCCGACTTCAAGGTAATGTTGAGCTAATGTAAACTaatgttgctggtgttgcgcTAAAGTTGCTTGTATGTTGCGTGTAGAT
TGGAGGAGACGGACATATAGTGGAGATCGATGAGACCAgcttggccaagaagcgcaagtacAACAGAGGACGTTGATATCAAGAATATTGGCTGTTCGGT
GGCGTGGAGAGGACGACGGGTCGCTGGTTTGGTCGCATCGTATTCGACAAGCGAACAAAGGCGACACTCCTCCCCATCGTTAAGAAGTTCATCAAACTTC
AGTAAGCTTTTTGTTTCTATGTAAATGTGGCAATTCAATAACCAACTGTGCGCTTTGTGTGTTCAGGACTAAGATAATGTCTTTCCACACAGCAACTCGA
TCAGAAAGAGATGAGGGGGCATTATTCGTGTTGGTTTTCGTTTCGTGCCCACGATAGGGCGAGGTGGGGCGGGTGTCGGTTCACCGCGAGAATGGTAGAT
TGGAAGTGAGCCTCTTCGCTGTTGTGCTTGTCCTtgtggcctcgtcctcagGGGGTTTGCTTTATCTATACCTAAGCTACCGATGTGGTTTCGTGGGATC
TCGTAGCCACCGGAAATAGGGTCATCCTTTTCGGATTGGCCCATCGGACATGTTCGCTACTTATGTGTGCGAGCGTGGCAACAAACGCCACACGCTAGAG
AACAGCCACCTACTGTTGAGTATGCATTACACACATAGTTGGATCAATCACAGTCTCAATTTTGTTGATCCCGTCGCTGGAACGCGCACCAACACCATAG
AAGGATTATGGGAGACCAGAATCGAACGACACATTCAGAGCATGCGCGGGTTGACGAAGGGCAAGCTAGATTCCTACCTGGACGAGTACATGTGGCACTC
CTGGTTTTTCCTCCCAAGGCCACAATAGGTCAGTACATGGCTGGTATAGTTGTTTAACAGGTCTCTGGTCGTCTGCCTGCCGACGAGTCCTTTGCTCGCA
CGTGTGTGCCTGCTGTGGTCGCGTTTCCAAGGTTCGTCGTCCGTCACCGACCAAAAGAACTTCAACACTTGTAGGCCGCTTTTCAGCTGCCGGACCGAAA
CCCTATTTTATTAACCCAATCCAATACACTAcctgtaacagggttacacaggctggtgtaattgggtacaccagatatacaTGTATAGCCgaactataca
cggacaagtatacggcaagccttctgtgtgtgtgCG