Description :
From Genome Similarity Track
Location :
Scaffold_275:283- 1369
Sequence
1086 bases(100 bases per row)
TCGGGTTGATCATTTTCACAATCTCGAATGGTCCCATCTTGCGAGCAGCGAGCTTAGCTCGTTTCCCATCAATGTCTTGAGTCACATGGGCGGAAGGAAT
GCGACGTGTATCTAGCATGACTAAGTCTCCTTCCTTGAACGTGATCGATGATCGCTTCTTGTCATAGTACTTCTTCTGACGTTCTTGGGCTTGAAGAAGA
TGCTTATTTGCCAAATCAATGATCTCTTGGCGTTTGGCTTGGAACTGTTTCGCATATTCAACAATTCCACGCTGAATTTGAGTCATGGTACTGGGATTGC
TCAAAGGATTCAACGGATTCCGTTCCTTGCGTCCAGTATCAACTTCAAAGGGCGACATACCGGTAAATGCGCTGACGAGAGTAGCATGAGCATACTCAAG
CGTTCCGAGATTATCCGACCAATCACGTCCGTGGTACGATATCATCCAGCGTATAGCGTCTTTCCAGAATCAGATTCTGGCGTTCGGTTTGTCCATCGGC
TTGGGCACGATAGGAAGTTGTAATGTGCAGACGAATTCCCATTAGCTTAGCCAAGGATGACCAGAACTTGGAGACGAACTTGGAATCTCGATCGCTGATG
ATGATCGATATGGCGAACAACGCAATCAAAGAAGTGATACGCAGTCATCTGTGCATCATCAGTCCGGTTGCACGCACGATACTTCGGGCGCTTGGACAAC
TTGTCGACAACAGTCAAGATTGCATCAAAACCATTGGAATCAGGTAATCCAGTGATAAAGTCCATAGAGACGACAGACCAGCATTCCTCAAGAATCGGAA
TGGGAATCATCTTGCCATTCTTGCGAGCATTGCTGTGTTTCCAGCGAGTGCAAGTTTCACAACTTTGCACATAATCGCGAACGTCTTGGTCCAAAGTGGG
CCAATGATACCATTGCGAAATGCGAAGGTACGTTCGATGAGCTCCAGGATGAGCAGCAATATTGAAGTCATGGAAGCAAGAGATGATGGAAGTTCGAGGA
TGATTGTCCCGTGTAAACGGAACACACAAGCGCATCATCGTCTGGTACATGCGGAAAAGTAAACCATTTTGTTTGACAATTGGTTG