Description :
From Genome Similarity Track
Location :
contig_36:282937- 284179
Transcript NameFunction/comments
g9197.t1hypothetical protein

Sequence
1242 bases(100 bases per row)
GTCGTGGGCTCCTAACGCAGGAGATAAACGTCGACGAGGCCATGGGGAAGGCGGCCAAGCACGGACATCTGGAGACTGTTCGGTGGCTGCAGCGGTACCG
CCCAGAGGCGCGCGTGTCGGTGTTTGTGCTCATCACGGCGGCGGAGTTCGGGCGTCTGGAGATCGTGCGGTGGCTGCATAGCAACAGGACGGAGGGCTGC
ACGTCCGCTGCCATGGATAGAGCGGCGGCTAATGGTCACTTGGATGTGGTGCAGTGGTTACACTACAATAGGGACGAAGGGTGCACCTACGACGCCATGA
CGGGCGCGGCGGAGTTCGGCCACTTAGACGTTGTCAAGTGGCTGCATAACTACAGAGACGAAGGGTGTACAGTGCACGCCATGGATCGAGCAGCAGCTAA
TGGCCACTTGGAGGTGGTCCAATGGTTGCATGAACACCGAGAAGAAGGGTGTTCCCGTCTTGCGATGGATTTGGCGGCCAAGAATGGACAACTGGAAGTG
GTGAAGTGGCTACATGAACACAGAACGGAAGGATGTACTGCAGCTGCCATGAATGGCGCTGCGACGGATGGGCACCTGGAAATGGTGAAATGGTTACATG
AGCATCGAGGAGAAGGATGTACAGGTGTGGGTGTGCGCCATGCGGCTGCGAACGGCCATTTGGAGGTGCTGCAGTGGCTCTACAAGCACTACGCGGCCGT
GTTCCAGTTATCGCAGGTGAACATTATGGATGACGCAGCCTCTCGCGGACAAATGAATGTGTTGCAGTGGTTACATGGCAGCAATGTTGAACGATGCACA
AGCGCCGCTATGGACGGCGCGGCGGCAAGGGGTCATCTAGACGTGGTGCAGTGGCTACATGCAAACAGAAGCGAAGGCTGCACCACGAAAGGAATGGATC
TGGCGGCATGCAATGGCCATTTGGAGGTCGTTTGCTGGCTGCACGAGCACACAAGTGCAGGCTGCACGACCAATGCAATGGATCTCGCTGCAAAAGGTGG
ATTCTTAGACGTCGTCGTCTTCTTGCATGAGAATCGACCCGAGGGCTGTACGTCTCGAGCTATGGATCATGCAGCAGATAATGGTCACCTGGCTGTTGTC
CGTTGGCTTCATGAGCACCGCGAAGAAGGCTGCAGCACAGACGCTATGAACGCGGCTGCACGCAACGGCAATTTGCACTTGCTGGAATTCCTCTATTCAA
GCGCACCGAAGGTTGCACGCCGCACGCTCTAGCTCGCGCGGC