Description :
From Genome Similarity Track
Location :
Scaffold_130:28292- 29668
Transcript NameFunction/comments
Physo_143128hypothetical protein

Sequence
1376 bases(100 bases per row)
GCGATCCGTGCGGAGCTCAAGTCGATGCGACTGCGTGGTGTGTTTCGAGCTGCCAAGTTGCCTAACGGACAACGCGCCATCGATACCAAGTGGGTGTTCA
AGATCAAGCGCAAAGCGGACGGCTCGATCGAGAAGTACAAGGCGCGCCTCGTGGCCAAGGGCTTCAAGCAGAAGTACGGCATTGACTACACCGAGACGTT
CTCGCCCGTGGTCAAGTATGTGACACTCCGCATGGTGATCGCGATTGCTAAGTATTTTGGCTGGCCCCTCGACCAACTCGACGTGGTGACAGCATTCCTG
TACGGGATAATGAAGGAGGTGGTCTTCTGCGTGGTTCCGGAAGGCGTCGAACTGGATGGTGACTTCGACTGCCTGGAACTGGTGAAGGCCATCTACGGTC
TCAAGCAAGCTTCGCGAGTGTGGAACGAGACCTTCGACGAGTTCGTGTGCTCCATCGGCTTCCAAGTGTCGGCCTTCGATCCGTGCCTCTACATTAAGGT
GGTGGACGGTCACTGCGTGCTTGTACTGGTGTACGTGGATGACGTACTGATTACCGGGAGTTCGCCCGAGCTGATCGCACGCACGAAGACCGACCTGAAG
ACGCGCTTCGAGATGACCGACAGCGGCAAGTGCGCGTTTGTTCTTGGGATCGAGTTGGTGGACGGCCCGGACGGCAGCGTGACCATGTGCCAGCGACGAT
ACGTGGACGACATCCTGAAGCGCTTCGCCATGGACGAGTGCAAGGCCGTGGTGAGTCCGGTGGACATGAGCACTCGACTGGTTCCAAGCGACGCGGCGAC
CAAGGTGAACGCTCCGTTTCGCGAAGCTGTTGGTGCTCTGATGCACCTGATGACCGCCACGCGCCCAGACATCGCGTACGCCGTTGGCTATGTATCGCGC
TTCATGGAGAACCCCCAAGAGGAACACTGGGTTGCGGTCAAGCGTATCTTTCGCTACCTGCAAGGCACCAAGACGCATGGGATCTGCTTCAAGCCGGGCG
ACAAGATCGACTTTCGTGGCTACTCGGACGCGGACTGGGCCGGCGACCTCGCCGACCGCAAGTCCACTTCAGGCTACACGTTCATGCTCATGAGTGCGCC
TGTGAGCTGGGGAAGCAAGAAGCAATCAAGTGTGTCGCTGTCCACGAGCGAAGCGGAGTACATCGCGCTCAGTCTGGCTATCCAAGAAGGCAAGTGGATT
CATCGCCTGCTATGCGAGATTCTGGCGGCCGCTAATGAGACTGGACCCGAACTCATGATCCGCGAAGACAACCAGTCGTGCATCAAGATGACGAAGAACC
CAGTGAACCACGGTCGCGCCAAGCACATCGACATCAAGTACCACCACATCCGCGATGAAGTCAAGCGCGGCGAAGT