Description :
From Genome Similarity Track
Location :
Scaffold_1050:2829- 5764
Transcript NameFunction/comments
Pytap_DAOMBR444maker-pag1_scaffold_1050-fgenesh-gene-0.0COP9 signalosome complex subunit 7
Pytap_DAOMBR444maker-pag1_scaffold_1050-snap-gene-0.5DEAD/DEAH box RNA helicase

Sequence
2935 bases(100 bases per row)
GTTAGATCGTTCCGTACGAGACGCTGATGAAGGAGCTGGCGGTTCCTACCGTTCGAGACCTCGAAGACATCGTGATCGACACCATCTACTCTGTAAGTTT
ATGTTTGTTTTCCACAAAgTAGCCATCATGCTTAGGGCACGGCTCTGATGTTGTTGAaGGGCCTGgTCCAAGGCAAGCTCGACCAAAAGTCGAAGTCGCT
GGTAGTCAAGTTTGCTGTGGGACGTGACACCCAGGATGCAGATATCGATCTCATGATTGCAAAGCTGACGAAGTGGTGAGTTTGAAGTCCAAATAAAATC
GAAGCTGATCTGGTTTCTAAGCATCGGGATTTGtAGGAAGAGTGAGGCTATGCTCATCTCAGCGAAGATCAACTCCATTTTAaGGTCGGTTGTTTATCGA
TGTCCATGCAACAAGTCTCAcTtCTAAcTtCAACATCACTACGTAGCCATGCGGACCACCTTGCTGAAACTGAGGCAGCCCGTGCAGAATCCATCCGCCT
GAAGAGTGTTCGTGCAATGAATGACCGTGGTAAGGGATCATTCACGAACACCGTTGCTTCTCCTTTCCGTGGAGATGAGTACATGATTCCAGACATGGTG
GGCGGGCCTCGACGAGGGTAAGCATTCCATGACTGATGTGCTTACACCTTTCATTGCTAACCCGTGATGTATGgTGATGTGTCTACAGTCCTGGTCCGAA
GCGTGGACCCGGAGGCCCCACAACGATGCGTAAGGGCCGTATCTGAGTCCATTGCAATCTGAATCTAATACGACTGCTCTGGGTATTACCACCCAAAAAT
CCAAACTGCTTctGAGTGACGTAACTTTGGGTGGTTGCTTTGCTTGGGTTGTGCCTGTTGTTGATCCACTGGAAGAGCGcGACGCCGACATCATGAAGCG
GCCGCATGGAGGCTCGTTTAACGGGCCcAAGAAGCACCACGCGTCGCACAATGGCAATGGAAGAGTGGACGTGGACACTCCGAGTAAGCGTGCGCTCTCA
GAGATCCAaCAAACCCGTCAGAAGCTCCCAATTTTCGCGCATCGCGGCCGCATTCTGTCGACGATCGCCAGCAACCGCGTCGTTATCCTGGTCGGTGAGA
CTGGCAGTGGCAAGACCACGCAGATTCCACAATACATCTTCGAGCAGGACAGCAAAGCATGTGTTGCAATCACGCAACCACGTCGAGTGGCTGCGATTAC
GGTGGCGCAGCGCGTTTGCCAAGAAGTGAACAAGGGCACCATTGGTGAGACGGTGGGctACTCGGTGCGATTTGATGATATGTCGACGCGTGATACGAAG
CTGCGCTTTATGACGGATGGTATGTTGGTGCGAGAGGCATTGCTTAGCCCATCgCTCGATCGCTACTCTGTCATTGTGCTTGACGAAGCTCAcGAGCGAA
CATTGCAAACTGACATTTTATTCGGCGTTGTCAAAAGAGCAATGCGGAAGCGGAAGGACCTGAAGGTTGTAGTCATGTCAGCCACGCTTGATGTTGCGCT
GTTCCAGAATTTCTTCAACGAGAGTAGCCCGGCGGTAATCCAGATTCCTGGCCGCATGTTTCATGTTGATGTCTTCTACACGGCGAAAACCCAGCCCGAT
TACCTCGATGCAGCTTTGATTACTGTACTTCAGATTCACCTAGATGAGAAGCAGACTAATGGCAGTATTCTCGTTTTCCtAACTGGTCAAGAAGACATTG
AAACGCTCGAGACGTTGCTAGAAGATTATGCTCGTTCGCTTCCGGCTGATGCACtcAAGCTCGAGGTGTGCCCAATTTTCGCTGCAATGCCTCGAGAaCA
GCAGATGAAAGTGTTCGAACCCGCCCTTCCTGGTGTCCGCAAGGTTATTCTGGCGACAAACATTGCCGAGACGTCCATCACGATCAATGGAATTCGTTAC
GTTGTTGATACTGGCCTTGTCAAGCAACGCTCGTTCGTGGCCAAGAGCGGCATGGAAATGCTGCTGACTGAGCCTGTTTCGAAAGCTCAAGCGTGGCAGC
GTACAGGTCGTGCTGGCCGTGAAGCTCCAGGTGTTTGCTATCGACTTTTCCCAGAAGACACGTTCGAGCAGCTCGCTGATCGCGCGATCCCAGACATTCA
ACGTGTGAGCCTtGAGGTTGTAGTTCTGCAGCTCAAGTGTATGGGCATTGACGACATTCTTGGATTTGACTTTATCGAGAAACCAAAGGTCGAGTCGCTC
GTGAAGGCTATGGAGAAGCTCTATGCATTGGGGGCTTTCGACTCGGCAGGCCAGTTGACGGAGCGTGGGCGTCACATGGCTGGTCTCCCCGTAGAGCCCA
TGTACGCAGTCATGCTgcTGAAGGCATGTGAGCTGGGctGTGCTGAGGAAGCTCTGAGTGTGGTCTCGATGCTCTCGGTTGAATCCATTTTCTATTCTCC
CCGAGACAAGAAGGAGCAaGCTGCCCAATCAAGAGCGAAGTTCGTCGCTTACGAAGGAGACCAGATCACGTTACTCAACATCTTTAATGCGTACAACGAG
TGCAACGTCAAGCAGCGTAACAAGTGGTGCCGTGACCACTTcATCAACCACCGTGCCATGACTCGTGTCGAGAGCGTCCGCACCCAGCTACGTGGTTACC
TCGAGAAGCTCGAGCTGCcgATTTCGTCCAGCTTTCCCGACATCGATCCTCTACGCAAGAGTATCGTGGCTGGTTTCTTCCTTAACACGGCTATGCGGTC
gCTCGCAGAAGGTGGTGGCGGGCTtGGCAGCAGCTCGAAGACCGCCTACAAGaCCATGTGCGGgCGTTCAGAGATCGTCAAGGTCCACCCGTCctCTGGT
CTCTTCATGCGTAATCCGCCACCCAAGTGGGTCGTGTACAACGAGCTCGtGTTCACGAGCAAGTACTACATTCGCTCGGTCGTGATCATCGAGAAGGAGT
GGCTTGTGGAGCTAGCGCCTACGTTCTTCAAGAAA