Description :
From Genome Similarity Track
Location :
contig_36:282841- 284206
Transcript NameFunction/comments
g8783.t1hypothetical protein

Sequence
1365 bases(100 bases per row)
CGTTCGTGGACCAGTCATCGCGCTGGACGGTGATGCGTGCGTCGCGCTACGGGCTCCTGCACCTGCTCGATCGATTGGCGCTAAATGAGCGTCGTGGGCT
CCTAACGCAGGAGATAAATGTCGACGAGGCCATGGGGAAGGCGGCCAAGCACGGACATCTGGAGACTGTTCGGTGGCTGCAACGGTACCGCCCAGAGGCG
CGCGTGTCGGTGTTTGTGCTCATCACGGCGGCGGAGTTCGGGCGTCTGGAGATCGTGCGGTGGCTGCATAGCAACAGGACGGAGGGCTGCACGTCCGCTG
CCATGGATAGAGCGGCGGCTAATGGTCACTTGGATGTGGTGCAGTGGTTACACTACAATAGGGACGAAGGCTGCACCTACGATGCCATGACGGGCGCGGC
GGAGTTCGGCCACTTAGACGTTGTCAAGTGGCTGCATAACTACAGAGACGAAGGGTGTACAGTGCACGCCATGGATCGAGCAGCAGCTAATGGCCACTTG
GAGGTGGTCCAATGGTTGCATGAACACCGAGAAGAAGGGTGTTCCCGTCTTGCGATGGATTTGGCGGCCAAGAATGGACAACTGGAAGTGGTGAAGTGGC
TACATGAACACAGAACGGAAGGATGTACTGCAGCTGCCATGAATGGCGCTGCGACGGATGGGCACCTGGAAATGGTGAAATGGTTACATGAGCATCGAGG
AGAAGGATGTACAGGTGTGGGTGTGCGCCATGCGGCTGCGAACGGCCATTTGGAGGTGCTGCAGTGGCTCTACAAGCACTACGCGGCCGTGTTCCAGTTA
TCGCAGGTGAACATTATGGATGACGCAGCCTCTCGCGGACAAATGAATGTGTTGCAGTGGTTACATGGCAGCAATGTTGAACGATGCACAAGCGCCGCTA
TGGACGGCGCGGCGGCAAGGGGTCATCTAGACGTGGTGCAGTGGCTACATGCAAACAGAAGCGAAGGCTGCACCACGAAAGGAATGGATCTGGCGGCATG
CAATGGCCATTTGGAGGTCGTTTGCTGGCTGCACGAGCACACAAGTGCAGGCTGCACGACCAATGCAATGGATCTCGCTGCAAAAGGTGGATTCTTAGAC
GTCGTCGTCTTCTTGCATGAGAATCGACCCGAGGGCTGTACGTCTCGAGCTATGGATCATGCAGCAGATAATGGTCACCTGGCTGTTGTCCGTTGGCTTC
ATGAGCACCGCGAAGAAGGCTGCAGCACAGACGCTATGAACGCGGCTGCACGCAACGGCAATTTGCACTTGCTGGAATTCCTCTATTCAAGCGCACCGAA
GGTTGCACGCCGCACGCTCTAGCTCGCGCGGCATACACCGGCCAGCTCGCGAGCGTAAGGTGGCT