Description :
From Genome Similarity Track
Location :
Scaffold_255:28284- 30650
Sequence
2366 bases(100 bases per row)
GTGCATGCAGCGCGAGAGGGTACCTCTCGCCTTAGAAGCTGTGATGGACAAGTTTGGTATGTATCTCGCGTTCAAGGAGGGTCGAAAGGGACAGCTCTTA
GCTCGACACTTGGTCATGCAGTACTTTCGACAAGCCAAGAATTGGCTGCTGGAGCAGTTCCCACAGCATCAAGCAGTGGTTGAAAAGAATTTGCTCAAGA
AGGGACAAACGCTCGAACGCCATTGCATGAAGCGTGAGTCAGGGTCGTCGTAAACAAGGCCCCAGCATGCACAAAGTCTGCTTTCAAGAAAATGATGGAT
TACTTGTATTCAACTGTGGTTACTAGTGCTGACTACCAAGATGTGGCGCTGTTGTGTCTGCTTTGGTTTCTCTTTGGGCGTGCATCGAACCTCACAATGC
TGCGGAAGACTAACCTTTCTATCGGCTCGGGCGAAATATTCTTCGTCCGTTTCATCCGAATCAAGACTTCTGAAGAGCAAGGTCTATCACTATTCCCTGA
CGGAGACTTCACCACATGTCCTCTGCTTGCCATAGCGCTCGCCCTCGTGACCCACTCATCGCCAACTATAATCGTGCTGAGTCAACTTCCTGAGCAGATG
GCTATTTCGCAGTCCACATTAGCTCCAGCAACTCCGCTCATCGATTTGCTCGATCAGCCAGAGGTTGTGGTGTCTTCACCGGATATACCGTCCACCGTTG
CTAAGAAGGAGAACAGCCCAGATACCGCTCCTGGTGTGCACTGCTACGTCAACCGTGTTCTTGATCAGGTCGCTGCAAAAGCTGGCATATCCGAGCGCTT
GACATCTCACTCTTTTCGGCGCGGAGGGGCGCAGTATGCAAATAGGGCTGGATTGTATGTACAGTGGATCTTTGACCGAGGCGCCTGGAATATGACAGCG
ACGAATAAGGCCTTCGCGTACGTCTTTAATACAGCCTTCGAAGACCATAAGGTTGCCCGGGTCTTGATTGGGTGACACCCCGATACCGACATCTCTCTCC
TATCACTTGATGTCTTCGACCGGTACGCAGACAAAGATACAAACTGTTGCGACAGCGCTCTTCAATGCATCTCACGGGCTCATGACTACACAATACAACG
TGAACGAAAGATGTTGAAACGCTTATCACTTACCTGCTGCTTTATTATCCATCGTTGAAGCAGCTCAAGAAAGACGGAATTGTAGACATACGTTTGGAAG
CGTGTGTAATCCAGCAAGGTCACTCCGTCAGCGATCTTCTAGATTGGTCTTCGCATCTAACCTGCTACACGAAGACTGTATGCAATTAAATCCCATCAAG
GCTCAAGACAGCACGATCGACATCACAAAGCATCCATTATATCTTCGTTAAGCTTCATTGATTGAACAGTTAATCAAGGTCAACCAAATACTCGAATCTT
GCGTCTCGATGATTGAAGCTGAGGTCTACAACAAAGCACACCCAAAACCTACACATGAAAGAAGTGAGGATAAAAGCAAAGAACCACCAGCCAAACGTCG
CCGAACGAGTTCGTCAACAAACCTGAAGGACGTCTGGTTCTCCTGGTATACCAAGGAACCCCGCCTCTGGGATTCGTTTGATAGCTCGAGCAAGCACACG
AAATCCACCGCCAAACTTGTCGCTGCATTCATGAAGCTGTTTCTTGCTAATGGCTTCGTGTTTGATGAGAAGTCTCCGCAGTATCGAGAAGATGCGTTGG
AGTTTGGCGATGTCACCGAAATGCGGTTACTTTCGTTTCTTGGCGAGCACAACATCAAAGCCCGCGGAGCCCAAAACGTCCTCAAGTCCATGCGCAAGCT
GCACAAAGCTGGTCATCTAAACAAACACATCCAACGATACAGACAACTTTAAGCCGCCGGGCGCATTGTAGATCCAGCACTTGCGCATACTACAAACATC
ATCGGATCAATTGTCACCCCGCAGTACCCATAGATGTTGGTATTCACGTCATTTTATACCGGCTGAGTGATACCGCACTAAAGAATAAGGAATACAACAA
GTACATATGAACAAGATCGGCGAGACGCGTTAGCTCGTCCGGACTCTCATGATACAGCGTATATAAAGGATAGTACACTAATCCATTTCACCCTTAAGCT
TCGGTGTCAGCTCACTCAAAATATTCTTGGACATGACAGAATCGTATCACGTGCCGGCGCGTAATTGTCGTGCTAGAAGGTCGAGCTCTCCGTCATCATG
TACACTTACTTCCGGTTATCATACATCATGTACGAATTGAGATCGCACATGGTCTTCTTATTGTCGCTGTAGTCCGACTGGAAGAATCCGACACCGTTCT
TGCTTGCGACGCCAGTCGTGGTCAGAGCTACAAGCACGCATCAATACTCAATGATTAGAGCCGATC