Description :
From Genome Similarity Track
Location :
contig_19:282800- 284443
Transcript NameFunction/comments
g5171.t1XP_009523048.1 DNA photolyase cryptochrome [Phytophthora sojae

Sequence
1643 bases(100 bases per row)
GTCGAGGCGGGCGATCGTCTGGTTCCGCCGCAACTTGAGACTACACGACAACTTGGCGCTGGACGCGGCGATCCACTCGCAGCAGCAGACTCTCAAGGCG
GGCGAGGGCGAGATGGCACTGCTGCCCATTTACATTGTGCATCAGCCCGTGAAGCAGCGCTGCGGACCCGTGAGGTTTCAGTTCTTGCTGGAGGCGGTGC
AAGACTTGGCCGACTCCATTGACAAGCTGCAGGGACGGCTGCTGGTGCTCAGAGGAGACGCCGAGGAGGTGCTACGTGAGATTCTCCCGGCGTGGGGCAT
CACGGATCTTTTCTTCGAGGCGGGCGTCATGCCGTACGCCGTCGCGCGCGACGAGCGCGTGCGGGCGATTGCAGCGGCTTTGGATGTCACGGTCGCGACG
TTCTGTGGGGAGACGCTATACGACCCGCACGAGATCATCCGACGCAATAACGGTGAGCCTCCTACGGACTACGAGCAGCTTCTGAAGATCACCGACGATA
TGCAGCCGCCGGGACATCCGATTCCCGCACCAGAGCAGCTAACCAACGCTGCAAGGTTCACTATCGAGCAGCTATTTGCAATGTTAGAACAATTCTGCCA
CCACAACCCACGCCTCGCGAACTCCATCGCTGGAATTGAAACGAGTACATGTACCACGAAGGCGTCACCCGAGCTTTTCGTTGTACCACCGCTCACTGCG
TTTGGATTAACCCCGCCAGAAACTCACATCTTTCTGTACGGAGGTGAAAGCGAGGCGAGGCGATTATTGAATGCCTTCTCCCAGGATCAACAGCGTGTGG
GACTCTTCGAGAAACCCCGTACTTCCCCAGTGACAATTGACGCACCGTCCACCACGTCGCTGAGTCCGTACCTTGTGTTCGGCTGCCTTAGTGCACGCGA
GTTCTTTCATTGTATTATGGTCATCCAGATACAATTTCCACAGCGGCCTGGTCCAACGCAAGTCACACTGGAAGGACAACTTATGTGGCGCGAGTTCTTC
TACTGTTACGCTTGCGGCACACCGAATTTCGATTCACAGGAGCGCAACCCAGGCTGCAAGCAGATCAAGTGGCGCCTGCGACCTGAGAACCATGAGCCGT
GCCCTGAAGACGGGTGCGAACGGGTGAGTGCCACCGATGACGCGGACGAGAAGCTGGCGATGCGTCAGTTGCAGTGCTGGAAAGATGGATGCACAGGCTT
CCCGTGGATCGACGCTGTAATGCGACAGATTAACCAGGAAGGCTGGACACACCACGCCGGCCGACACGCCGTGGCTTGTTTCCTGACAAGAGGCGTCCTC
TATATCTCGTGGCTACAAGGCGCAATGTACTTTCAGGAGAAGCTCGTCGATATGGACTGGGCGCTAATCGTTGGCAACTGGCTCTGGGTTAGTGCGAGTT
GCTTCTACTCAGACTATCGTCGGGTGGCGTCTCCGTCAACCTTCCCACAGCGGTGGGACAAAGAAGGTCGGTTCATTCGCAAGTATATTCCAGCGCTCCG
TAACATGCCAGACAAGTTTGTGTTTGAGCCCTGGAAGGCTCCGTTAACAGTACAGCGTAATGCTGGGTGCCTCATGGGAAAGGATTACCCGTTTCCTATC
GTAGATGGGAAGCACGCAGTGAAGCGATGCATCACCGGCATGA