Description :
From Genome Similarity Track
Location :
Scaffold_72:28278- 34087
Transcript NameFunction/comments
Phyca_LT153420743ubiquitin-protein ligase
Phyca_LT15345109643hydroxy3methylglutarylcoenzyme A reductase putative

Sequence
5809 bases(100 bases per row)
cgcttgggtccagaaactcgctagtgtctgagatcgaaatcgaggaagtgcttgaggcagcggaggctgtacgtcaggattatcatgactcgacgtggga
gtatatcaaggctattacaatgttgttgcttttcctaagcacttcgcatgtcgaagatttggcttcaattacaagcctatcttgtgtttcctctgggctc
agtacacttgtaaaagtcttctatccgtatctggtgaatcagcctcgagaagaactccgtgaaaattggcattctgttagcagtctcctggttgcgatgg
gtctacctgtggatcgcttgttcatcttcctggaaccagcgtgcaagactctccttctgtccgtggagttgagcaggcgatcgaatcaggagtcgcagag
tgaagaagacctcgacgtttatcctaaggttatagtcgtctgcgaccgggacgacgcgcttcaatcgagtgttgactacgtttggcgctctcatctctct
agtgaaatgatcctatcgaacttttctctgttccccttcttcaaaagttcattcggtgaaaaggtcgtggatggagtaaaggtcgaagaaggagaaggga
agggtccacttaaggaatggtttacgctggtaggtactcaactcatatccaagtggaagcaaataccgatatcccagcgtttggcagagtcgtcaaccaa
gattactgcaagtgggaatgcgatcacaatcccaggggcttcagatatcattaagccaggctttcagctcgaatgggagacaactgaaggagaaaaaatc
cgacgagttgtcaacaagagcgtggaagacgacactttcctactagaccgcactgtgccgacccattccttcacaacgtctcagttgaccataagccagc
ctaccaccgcaattttcgaatatgttcaaggatcggagagtttctggcttaacgagaacatccgtgagtctcctgagacccgcaacatgcttgtatttgt
aggttggttcctggcctgtgctgtaacccacttcagctcgacccaagtgaggatacacccgctgttcttccgcttgttactggaccctcagcattgtgtg
aagctggaagaattgcagtcatttgaccttcaactgttccagtctttgtccaaaatgaaagacatgaaggcgtcagattttgcagagtacttgaagttcg
aaggggctgatgagagcttgactgcaggggaatacataaacaaagtgcttcaagacaagttcggggcggagtctgtaatcggttggcagcttcaggctct
tcgacgcggatttagtcgtgtcattgctcttgatcagctttctcgagtcgggatttctgccatagagctggtagaaagcgtttgtgggggttgcgctggg
cctggggatgacttcgttgttgatgaagttttccgtgtcgctgccgatgcagaattcacggcctgtggaccattaatgaatgcgttctggaagacagtga
acggctttgagccacaactgaagcgcaagtttatcaagttcgtgacgggggtggatactctaccactgacaggaacggaggtatgttcatgatgttcttt
atgttttagcatagagctgtcactgactatcttcgtgtttgaaccttcagtttctacgaattgagatgccattcactgcgatttctgtggctgatcacga
aaagtgtctgcagatgctcccacaagctcatgtacgtggctttggtggatttctctagttgtttgttgactaacgggcatttctccgtttcagacttgtg
ataacacactagaactgcctcattactggaaggcgctttgctggagagagcaacacgatgaacacgaagcgaatgcgaaactggaagaagagttggcact
tttattaagaaagaaattgcaagatgcagtggagtactcgagcggatatggactggatggcacgtctgcagttgctggagtgtttggtgccaaactcgaa
ggatggcgaagatgcggtgacaaaagtgggggagagttatgactcgttggggctccccgccttgtcagagggacaaagtgcagcggatctaaccacggaa
aacgtgtcgctgtctccacagacatcaaagaccgagcaaggagaggcagaaccagtcgaaccggaagtcaaaccagagccaacaactttgtcaccacgcc
cagatgagtcctacgaggaggactatgacgactgggaagaagagtccatggcgtgagtacgagactgatgaccggcgatcctcacaaagaagatatacag
ttgtaatttaaggaagaccaccactacccaccagcgctaaagaagccggtcgctattgtgcttgatctcaaactgcagcagcagttaccagtagcaatca
ctttaacataacccatcgagtgataagcgtccaattgcagtcacgtcgtccgtcgcacgaagatctttgcaatgaacaaccagtagatatgcttacatgt
agcaacttcacccaggggaatcaagagtgagacggacttctcctctaacagcagctaggtggaaagaacttcgacggcgacagtggtggaaacattcgcg
tcaatcttccgggggtgctggatgacgtgcaacttaaacgtctcggcatctttgcccaacagttccttggtgcactcctgttgttccctcgagtcgttgt
tgttcatctatcctgtaccatgcctacatgtattaatattaatacaacgaacaatgctttggttttaaagttgcttcaacgttgcgccaagcagattacg
ttgcgccaactgacgtgtctttcccgtcgtggcctcacgtacgtcacttccaatttcgctgtgctggggccatgaccaatcagctctcggacggtgacgc
gctcgcggtgatggcgacgcctcggacggagctggacgcggcactggaccagacgctgttgctattgcgcacagctctcaaagcctcgcagggcgtgacg
ctagacgacgcgttgcagcagaaggtgacgcaggtggcgactctagccgcgcaggtgcagcgccgatgtgtggaggccaccagatccaagcgctttgagc
ctctggagcccagtcacgacgtcagtgagagttgggccaacaatctgccggtggaagcgacgccgcagccctcagtctggtccggattctacaacaaaac
tctacgcgagcggttcgacgtgctggcactcatgtacccaagactcaagacgctcaagacgcagcagacaggtggagaagcagttgcagatattctacca
cccaccgacccagcagccagactgggcgaactgccgctgcgtacggccaacctcatgatcgagaactgcattggcgttctgggtgttccactcggtctcg
gcctcaacttcgttattgacggcaagagcttgtcagtgcccatggctgttgaggaaccttcggtggtagcggcggcctccagtgccgctaaactcgtggc
tgctgctggcggtggcttccgcacagcgacatcgggcaacatcatgacgtcgcagatccagcttgtgggtacggaggacatcccggcggcgatcgcagct
attgaatgcaaccgagagcgattactgtcgattgccaacaccacactgtgccctaacatgaagaaacgtggcggtggtgctgtggacgtttactgccgtg
ttgtcagccaagctgctcgatctgcagccattgcgaccgctggtagcgcctggtacacttcgtgcgctgatgaacttgtggtgaacgcctcagacccgca
gacgcagttcttggtcgttcacattgacgtggacgtgtgtgaagcaatgggtgccaacattgtcaacacggtagcggaaggactgtcggaagaagtgtcc
aagatcacccgaagccgtgtcggtctgcgcattctcaccaacctctgcatgcagcgccgagctcggtctgcgttcgagatccctgtgaagaaactcggct
ggaagggagtggaaggtgaagaggtggccaaccgcatcattgaggcctacaactttgccgctatcgatccgtaccgcgccgtgaccaacaacaaggggat
tatgaatggcgtggacgctgttgcagtggccaccggacaggactggagagctatcgagtcggccgcgcactgttacgccagtcgttcaggacagtacgcg
tcgctctctcactacgaaatcggccttgccagtgacgggtccgggacgcgcgtgttgcgtggcagcctcgagatgcccatcgcagtcggatcgaagggcg
gcgcgttgatgacgcaccctggttacaccgccactcacgcgattctccagcaaccgacggctcgcaacctgagtggcatcatcgtgagtgttgggctagc
tcaaaactttgcagcaatccgtgcaattgccgtgacagggattcaaaagggccacatggctctccacgcacgaaacatcgctgttgctgctggtgcacct
agcgaactggtgtcagaagtttgcagctacatgctgctgcgaaagtctatcaacgtggagacggcgaaggagtacttgcacgcccacgctgtgttttcag
agatccagagcaactcgcctccaatctccccggtctcgatgacgctgccttccatgttctacgtggaaatacccatcccagagctagaggacaccatcag
cctgaacattgccttcgaggctatcaacaaacacccgcagtatatcgccatcatggcgccgagcactacaagcaagggcggtcagacgctaacgacattc
cagaggcagctactgggcgacaagggctacaaccagcttgagaaaatgtttcggtttctggcctctatgcgctccatcgttatctcggcttcgagctcgg
agggcgatctgctgctgtcgcgctccaacattgccctgcagaacaagctccagctgctgtccattctcattaatatcattgcttaccgtctcatggaggt
gcgtcctcagaaggtccgcacgttcatgcggcaactgctggaggcgagtagtgggtctacaaatggatccaacgacggagaaatgcacgagttggacgcc
aagtttttccacgatctaatggtagagaatgtggagcctggcgatgaactgttggcgacgggtttaccactgttcctcgctctgtggcaagtgctgcact
atcacatcgagcaggaggtaccgcacaagctgcttcgtgttcgtctcgtgaaggagcaatgggggctgctgaacgatatcgtacggagttacgagctcgg
tacgctttccgacgacaccactggcgcgtctgttgctgaccaaccgcttgaggagaagtttttggagtatgtcgcagtgcaagcgacgcgttggcaagcg
acgttgctgttgctcatcgattcactggcgctggtgtcggagctggtgacgcctgagcgactggacttccttgcgcgcattggcgaatacatggagtggg
aaggctccatcgcgcacgatttagcgcggtaccaacgggatgctaccgagcgcgtacccaacgcctacctgtattggctttctcagcgagggatccctca
ttcggagggtaagaagtacgagcgtgaattccgcgacgtagccgacgccttagcggcggataaatgggaaaaactgctgcaggaagcgcgacgggactcg
tgggctgctgccacgttttcattgccagcagtggagcgcgtcatcggtctcatccgcgacatctacggcgatcacagcggtcgcagcatcaggaaagagt
cattttaag