Description :
From Genome Similarity Track
Location :
Scaffold_4:28273- 32409
Transcript NameFunction/comments
Physo_262607Eukaryotic/viral aspartic protease, active site

Sequence
4136 bases(100 bases per row)
TGATCGCCAGTGGCAACGCACTACCGCCGCCTGCGTACGGCGCGGTGTGCGACATTGATGTTCAAGGCAACGCCCCTATCAAGCAAAGAGCTCGGCGAAT
TCCGCTGAAATACTTGCGGAAGCTCTATGAGCTGCTGAAAGGGCTGCTGGAGGCAGGACTCATTGCGTTCTCATCCAGTCCGTGGGCCTCGCCGATCGTA
ATCGTGCTCAAGAAGAACGGCCTCGATATACGGCTATGAATCGACTACAAGATGGTCAACGCAATTACGCTCATTATGGAATATGCGATGCCGTTGGTCG
ACGATCTACTCACAGAAATGGAGAGCTACTCGTGGTTTTGTTCGCTGGATGCTGCCAGCGGTTTCTGGGCGATCATGATGACGATGCGTGCTCGGTGTGT
GTTGGCGTTTGTCTGCGCGCTAGGTCACTTCGAGTGGCTGCGCATGCCGTTCGGTTTGAAGAACACGCCGATGATCTACCAGCGAATGATTGGAAACTCA
TTGTGGGGCTACGTGCAACCGAAAGGCGGCTGGGAGGCTTGCGCCGAGCGAATGAAGCAGGCAGAAGCTAAGGCTCAAGCTCTACGTAAGGAGTTTGTGG
TGAAGTCGCAGAGGTCGCCGAGTGTCGATCGACGCGACCTGCGGACGGTATACGAAGCGGATCACCTGGCCCTCGCCGGAAACGACCCGCTGATGGAGTT
GGTCAACAGCCCGGATGCAGATATGTTCTCGACCGGCGAACCTGACCAGTCGAAGCTGGTCCCGGTGTTCCACCGTCATTCGTCGACGACATTTGCTTCG
GCGGGTCGACGTTCGATGAGTGCTTGAAGACGCTGGACCGACTCCTGTCGAGATTCGCCGAGTGCGGGATCAGCGTCAGCTTCACGAAAAGCATATTCGT
CCAGCCGAAAGTGGATTTCTTGCCGCATGTTGTCACGGGGGAAGGAATCCAGGCAGACGGAAAGAAACTCGCGGCAATCGCTGAGCTCCCGTCCCCCTCG
TCGAAGAAAGGAATGCAGGCGTTCCTGGGTGCCCTGAACTACTACGGGAGGTTCATCCAGGGATTGGCCGTGTACGGAGCTGTGTTGTACCAGATAAAGG
AGGACGACTTCGCACCGGGGGGTGACCTCAGCGTTGCCCGCAATGCCTTTACAGCGTTACGCCAGAAGGTCGTCGAGGCACCGATCCTGCGGCACTTCGA
CGGCTCCAAGGACGTCTACATCATGTTGTACGCCAACGAGTGGGCATTGAGCAGTACGCTCATGCAGATGCATGCCGACTTGCTCCACCCGGTGCGGTTC
TGCGGCCGGGTGCTCAAGGAGAACGAGCTCAACTAACATCCTGCAGAAAAGGAGGTGTTGGCTCTCCTACAGGTGCTCAAGGTGTGCTATACGCTGTTGT
CCGGTAAGACGTTGCACGTCTACACCAGGTTCTCAACTTTGGAGTGGGTGTTCCAGTCCAAGTCGTTATTCGAAAGGACGGTGCAATTCGCGGTGTTCCT
GTCGCAGTGGCACCTGAAGGTCAAGCGAGTCCGCGAGCGTGACGTCGAATTCGCCAAGCTGCTGCAGTCGTCGATCACACCCTTTGTGGCGCTCGACGAA
GCAGTGGCCCCGCTCCACCGCCCTCGAAGGGGCTGGCCCCCCATCTGCTCTACGCGAGTATCCCTCGAGACTATGAAGGCCCTGTGCTATCTTTCGATGG
GTCAGCGAAGACAGAAAAGCATGGCGGGCATGGAAGCTGCTCGTGGATCCTGTGGCGCTTACCGGCTTGGGACATTGTGATCGCTGCGAGTGCGCACCTG
CCATCGACGACGGTCGATCTAGCCGAATATACTGGCATGAACAACGGAGTCAAGGCGGCGATTGAACACGGGATGACCGATCTTATTATCGTCGGCGACT
CCAGGCTTGCAATCCAGCAATCCATGGGGGTGATAGCCTGCCGGGCGGAGACGCTGCAAGTCAAGCTGAAGAATCACAAGGAACTCACGACGCAGCTCAA
CTCAGTCCGCTATCTGCACGCCATAAGGATGTAACATATCTGCCGACTCGCTGGCCACGGAAGCTCTGGAAACCCAGGTCACCAAGGTGGTACTCAGCGA
AACAAGGAAGGCGGAGCTCAAAGCGCTCAATCGAATTCCAGAGGTGCTGTATGTCGATGAGCAAACCGCACTGGAGGCAGAGCGGAACACTCAACGAGCG
GAAACCACTCAGCGAGCAAAACCTTCAAGTGCTGATGAGGTCACCGAAGAACCTCAAGTAACTGCAGTCACCAGAAGTCAAGCTCGGCGAGTGAGGTTCG
AAGATCCCGAAGTGCAACGGCACACTAACCACGGTGACGTGAGAAGTCAGGAGGTTGAACAGACAGAGCCAGAAGAGACGCCAACCCCTCCAGAAAACGC
ACCGGAGTCGGCGAGCGAAGCAAACGAAGCGCAGATGCAAACGACGACATGATCACCAACGGACCAGCTCCTGCTACTCCTGAAGAAGTCGACGAACAAC
TAAACCCGGTAGCGGTGCAAGCAGAACGCATACGGCGAGTCCGTATTGCCCAAGACGAAGAAAGGAGGTGGCCCGACTTGAAAGCCTACCTCCGGGGCGA
CATTGAGTCCCTCGACTTCAAAAGGGCAGCCAATGCGGGCAAACTCGCCGACCGATTCGTCCTGGACGAAGACGACGTGCTACACTATGTGGGTAAGGGA
CGCAAGCTCGACGAGGGAGGCGAGCCGGAACCTAAGCTGAGACTGGTGATACCGACGACGATAATTGAAGAAGTCCTGCAGAGTTGTCACGACTCGATCG
AAGGAGGGCATCAAGGGATAACGCGCACGTTCCACCAGGTCAAGAAAGATTACTACTGGATTGGACTGTACGCCACGGTGGCTCGCCATGTGTGCGCATG
CGCAGACTGCAGTACCAGCAAGGGCAAACCCCAATTGAAGGGGTAGTCGCCGGGCAATGTGCTCGCCGACCGCCCGTTCCAGCTGGTATCGATGGACTTG
GTGACGCCGCTGCCGAAGACTCGGCGAGGCAACACGTCTATGTTGCTGTTCCAGTGTTCCTTCACTGGCTACGTTATCGCCAAAGCCATGAGCAGCACCA
AGGCACAAGACGTTGCAGATGTTTTCGAGGAATATGTGTTCCGACGCTTTGGTGCCCACGACACGATCGCGATCCACGCTTTATGAGTGAGACCTTCAAG
GCATTCTTCGAGCTGTCCAGTAGAGGTCTAGAGCGACGCTCAGCTACCGGCCCCAAGCGAACGGTCAGCAGGAGCGGTCGGTCAAGTCGGTGATCTAAGC
CGTGAACGTGTACATCGAAGACCCACTCCAGCAGGACTGGGACGAGATAGCTTAGAAGATGGAGTATGCGATCAATAATTCGATGGACACAACGAGGAAG
GAGACACCCTTCTACCTCGTCCACGGATGGGATGCCCAATCGACACTCAAGGCAATGACAAGTTCGTTGAGACTCGGCGATGGTGATCAGACGGACGCTG
CAGCCTGGAGACGCGAGGCCAGCCGACAACACGAGATTGCTCTGGCAATGGCGAAACACTACCAAGCCACCGAAAAGGTTCGGCGAGCGAAAGAACGCAA
CGAAGCCCTTGGAAGAATTGAACGGCTTGCTGTACCGCTCGACGAACGTGGCGATCCTGGCAAAGCAACGGTCGACGAATCAACGGGAAAACCGGTCCAT
CGCTCACTGTTCCAGCCAGGGAGCCGGGTATGGTTGTTTATGGAGCGCGTGAAGCCCGGCCTGACCAAGAAGCTCGCTCACAGGTGGCATGGCCCTATCC
GCATCAAACGGACGGTGGAGGAGTTTGCCTACGAGCTAGAGCTACCTGACAAGACCGGTTACCGCTTCTATCCTGTGGTGCACGTGTCCAGACTCAAGGC
AGTGAGCGAAGATGACCGCAGACCGACTGCAGAACTGATCGACGGACTCGGCGAGGATGAGAGGTTTGATTTTGATGAGGAACTTCTGCCAGAGGACAGC
TGGGATCCGGAAGGAGACGGTGATAAGTACGTCGTCGAAGCTATTCTCGACGACCGATGGCCAATTTCGACAGGCACTGAACGGAAGCAGTGAGAGTTCT
ACATCAAGTGGCGAGACTACGATAAGCCCACTTGGG