Description :
From Genome Similarity Track
Location :
Scaffold_83:2827- 9029
Transcript NameFunction/comments
Physo_140194reverse transcriptase

Sequence
6202 bases(100 bases per row)
TTCGGGCGCTGTTGTTAACAACAGCGCTCGTATTACTTTCCAGCGTGTAGCGCATGGTGGGCTTCGTACGCCCTCACCATGTCCGGGACGTCTTCGAGCA
AGACGTTCCGCGGCTCCCGTGTATCTTGGTTGGGAGGGAATCCTCTCCAACGGATACGAAAACGAACCCGTTGCCTGTTCGTTCTCGGGATACTGTGACC
AACAATCCGCTCAACTATCCATCGAGTTGAGCCGTGTGCGTCACGAATTGGCGGTGGTGGTGGTGGAAACACGCCCCGTGTGTGGTCAACTTGGTGTTGA
CCCTGATCTCGCGTCTCCCCACGACCAAGTCCCGGTCGTGGAGTAGTTCCAGAGCGCTGCGTTCGGCGCTCTGAAGTATTCACAGTTTGCGGCGGCCTCC
CAGACTGCCTCGATCGTTCTGGCCGAGCTGGACCATTAGCTCGACCCGCTCCTCCAGCGCGAAGTCGCGCAGGAGAGGACGATGGCTTCCGCCGAGTCTT
CTGCTTCGGTTCAGCCGAGCTAGGTAGCTCGTGCTGCAGATATGGCTTCAGCCTTCCGACATAGAACGTCGAATGGAGACGCATACTAGACGGTATGTCC
AGTGTGTAGGCGTTGCCGTGACTTGCCAGCACAGTGAACGGCCCGATAAAGCGCGGAGCAAGCTTGTTTGCCCCGAAGTCGTAAACGGCATGTTTAAGCA
GGTTTTGAGTAGCTAACAAGCCTAATGAACCCTTCTCGAATTCATTAGTGTTGCCCCTGCCAACATTGTCTGCGTTCAGCTTCTGTCGGTCGACAGAAGC
TGCAATAGCGTCTTGGACAAACCGAATGACGGCTTGTCTGCGCTGGACGAAGCGAATTGCGTCCGAACTGAACTCGTTCAGCTCGCTTCCAGCAGTAGGC
CCTGCCTCTGCGTTGGTCTTCGTGGTGTCTGTGCCCTACACAGACCCGTTCTTCTTCTTCTTCTTCTTGCGCGTAGTTGCGGCTGACACTGTGCAAGTGT
CAGCGGCATTCTGCGGCTGCTGCGTTGCAGTCGTAGATCCTCCCCCACTTAAGGAAGGAGCCACCGTCCCGAGTAGACTCGGGAGGCGTGGGTGCCTGAT
GGCGTTCACGTAGAACGGTGTATGCCCGGTCGAGGCATGCACCGAGTTGTTGATGGCAAACTCCGCCATCGGCAGGCACTCCCTCCAGTGTTGGAATGAG
TGAGCGTAGCTCTTAAGCACATCTACGAGCACGCGGTTCACGCGCTCGGTCTGCCCGTCCGTCTGCGGATGGTCCGCAGTCGACATCGAAAATTGACTCC
CAAGAAGTGTAAACACTTCTTGGCAGAGATGCGCAGTGAAGCGCGGGTCTCGATCCGACACAATGTCGATCGGCATGCCATGGTGTTTGAACACCATGTC
AATGAACAGACGCGCCGTCTGTTTCGCAGCCACTTCAGCGGGTACCGCAGTAAGATGTACCATCTTGCTGAAGAGGTCAACAAAGACCACAATGCCCGTG
TTCCCCTGGCTGTCCGGGGGAAGACCGAACAAGAAGTCCAAAGACATGGACTGCCAACACTCCCGTGGAGTTGGTAGTGGCTGCAAGGGAGCCTGCGCGA
AAGGAGCAGGCTTCACACGTTGACAAACCTCGCAAGCACAGACGTACTTGCGCATCCATTTGTACTGGTGGGCCCAGTAGAAGTCTCGCGTGAGACGAAG
GTATGTCTTCTCACGGCCCGGATGCCCCGCAGTCGGAGCATCGTGATACTTGTACATGATCCTGAGTCGCCGGTCATGGTCATTGGGCACGACAACGCGG
TCCGCGTTGTCGTCGACTGCACTGTAGAGTAATAACCCGTCGTGCACCCGATAACGGTGTGCACGAGCACGAAGATGCTTCGGCAACTTCTGACGAGCTT
TGTCAGAAGGCGCTGAGCCGTAGGCCAGCAAGAGCTTCGCGTCCGCGTCGTGCGCGTCCGCAACCTTCACGTCGTCTAACAGTGACGACGTTGCGGTGCT
CGATCGCATGGCGTCAATGGCGTTGACGTCGGCATCAGTCGTGGCGTAGTCAGGTCGACGCGAGAGCGCGTCGGCCACCACATTGAGTCTTCCGGGTTTG
TACTCAACTTGGATGTTATACTCTGCGAAGAATGAGAGCCATCTCGCCATCCGTTGCGAGATGTGCGGCGACTTCACAGCCGTCCGCAGCGACGCGTGGT
CCGTATAGACCACGAACGGTTTGCTTCCGAGTAGATACACTCGGAACTTCGCAAGTGCGTACTTCATGGCAAGGAGCTCCTTGTCATGAACCGGGAAGCT
GCGCTCGGCTGGCTTCAGCTGACGCGATTGGTAGTAGACGACACGATCACGGCCCTCGTGATCGTGCTGTATCAACGCACATCCGATTGCGAAGTCGGAT
GCGTCGCACACAACGTGGAACGGGCGATCTTGGTTGGCCACCGCCAAGATCGGCGCCTCAGTCTAGCCCTGCTTGACTGCATCGAAGGCCTGCTGACACT
CAGGAGTCCAAACCCACTCGGCGTCCTTCTTCAGGAGCTGTGACAGCGGGCGTATCATGCCCGCGTAGTCCTTCACGTACTTTCACAAGTACGTGGCCAA
GCCAAGGAACTGCCGCAGTTCCTTGACGTTCGACGGCGTCGGTCACTCATTGATCACTCTGTCCTTCTCAGGGTCAGGGCGGACACCGTTCTTCCCGACG
AGACACCCGAGCACGGGTATCTCGCTCGCCCCGAAGATGCACTTCTTCAGGTTCGCATAGAGCTTGTGCTTGTGCATGAGCGCAAGCAGCTTCCGGAGAT
GCACCTTGTGCATCTCAACATCGCTCATCCCGTCCGCAGCCCGGCTGTGGACGAACACATCGTCGAAGTAGCTCGGTGCGAAGTCGCGCACCGAGCGCAA
CAAGTGCGTCACGCACATGTTGAAGGTCGCAGGGGCGTTCTTCAGACCCTGTGGCATCACTAGCCACTCCCAGAGCATGCCGCTCGACGTGCTCACAGTC
GTGAGAGGGATATCGCTCTCACGTATGAGGATCTGATAGAACCCATCGCGCAGATCAAGAGCACTGTAGATAGTGCTCCTGGCCATCGAATCGATGATGA
CATCTTTTCGCGGTATCGGTCGGTATTGTCGCATTGTTCAGCTTGTTGTACGCATGAACGATGCGCCAGCCGCCCTGTGGCTTCTTGACACAGAACGTCG
GAGCACTGTGCGGGGACTTCGATTCCCGCACTTGTCCAGCTTTGCGACGACTCTCAAAGAAGTCGTCGATCGCCTTGACCTGCTCTCGCGGCAGTGGCCA
CTGCCGCGTGACACAGTACTTCGTGCCCGGCACGAGATCAATCTCGTGCTGGATGCCCTTGTCCTGCGGAAGCTCCGCAGGGATCTCTTCCGGAAGCACG
TCCGCGTGCTCCCGTAGAATCTCGTAGAAGGGACTCGTCTTCAGCGAGTCCCAGCTCTGCTTCTCAAAGCGCTCCTTCTTAGTCTTCGCACTGAGAGTGT
CCTCGCTCTCAGTGGTGCTCTCCATGAAGAACTGCCTCAGTTCTTCATTCTCGCTCTTCGTTCTCTCGGCGTCCGAAACTTCGTCGTGCAGCGGGCAGCC
GGGCTGCACGATAGCATGCAAGTCGTTCCGGTGCGGGACGTTTTGCAACCGTCCGCACCGTCTGCAGCGTCGACTCCCGGAGTCGACACGCCATCTTTAC
CTCGACGCCTGTTATTGGCGGAGCCCTTTATTACAAGGGGTACGTCGACTTCCGGAGTCGACGCGAAATTCCTTTTCGCGGCGCCGGTTCCCGGAACCGT
CGCGACTTTAATACCTCGACGCCAACCATTGGCGGAAACCCCCATTACGTAGGGTGCGTCGGCTCCCCGAGCCGACGAATCAAATTCACTCAAGCCATCG
ACTCCCGGAGTCGACGGCGCTTCGTCACCTTAGCTCTTATTATTGGCCAAAACGGATCCAATTAGATTCACGTCAGCCTCCACGGCTAAGGCGTGTGACT
CGCCTGCGTCATCCGTGCCCCGTGAGCTCGGAGACTCTTTCTGATTCGCTGAAAAGCGGGTGTCGATCTCCGAGATCAACACATTTTCTCCTTCAGCCGT
CGGCGGCGACGCCGACGCTTGCTGCTCTTGCGCGCGTGCTCGCGCGCGCCCAGGGCGCTCCGGGACAGCGGCATTAGGTGCTGTCTCGAGTGGGGAGTCG
CGCGCATCTGTCGGTGCGTGCGTAGCGGCAACAAGGCCATCGCTCACTGTACCGCTGTCGCGACCGAAGCGCACGAGTGTGCGCTTCTCCCAATCGATGA
CCGGATCATGCCGTGCAAGCCACGCCATGCCCAATACAATGTCAAACTTATCACCCAGATGCAGGACGATAAAGGTCTCGACAAACGCTTGATCTTCATA
CGTGAAGCGCACGCGCACCATGCGCTTCCCAGTCTTCACGACGGCACCCGTTGCCAGTCGTACCTCCAACATACTTCGAGGTATCTTTACCTCCTCGAAG
TCAAGCCTTGATAGACTTCGCAGTCGAACAAAGTTGTTCGACGCGCCCGAATCAACCAAAGCACGAAGAGAGTTGCTCTCTCTCTTCGAAGACACGTCCA
AGATGACAAGGTTCGGTTTGTCATCATGCATTTTGCAGTGAGAAGGGTCCTCACTGGGGGCTGCAGTCCTCAGTGTCGCATGTCCGAGTTGGACACGCGT
GACTACTTCACCAGTAGGGCGCCCTGCGCCTACTGGGTTCCAGCGGTTTTTGTTTGTCCGCGACGATGCCCGGCATCGCCGCGTCAACTACCATCTCGGT
GCACGGGTGCCGTGCACTCTCGGGCATAGTGACCGATCCTTCCGCAACGGAAGCAACGTACATTACTTCCTTGTTGCTGTTGATAACCAACAGCCGCTGC
ATTCGAGAGGTCCATTGGTTCCGGACCTCCCGCTATCGCGACCGGAGGCGGTTGCAGCCTCGGCGCATTCGCATGCAGTTTAGCCTGCCTCAGACTAAAC
TCCTCCTGCATTGCAAGAGTAATCGCAGCTTCGAGAGTGCCTGGGTACTCACGGAAGAGATAGGTCTTTACAGGCCCATCTCTCAGACCCTTCATGAACG
TGACGATCTTGGTCGCCTCGTCTATCGGGTTGGTCACAATGCTCGAGACCAAGTACCGTGCTCTCTGCGCGTAATCATGGACATCGTGCTTACCCTGCTG
TAGGTCGAGGAACTCTGCCCTCGACCGAAACTCATTTTGCGGGGGCTCAAACGCTTGCCTGAGCTCCTCCTTGAAACCCTCGTACGTGCTGAAGCACGTA
GGATCAGAGAGTCGGCGTCCATACGCCCAACTTCTCGCTCGTCCGCCAAGTCATGACATGGCGAACGCAACCTTGGACAACGGGCCGACGATACGCGATG
GCAGTGTCGAGTTCGACAAGCCAACGGAGGAGAGGCTCGCCCTCTCTTCCGACATAGTCGCTCACGTTTAGCTTCAACGATTGCCCACTCCGACGCCACC
GTGGTAGAGGAAGCAGCATCACGCTGCTCCTTCATGATGAACCCCAGAGCAACACCATGTTGCTCTGTCGGCGATAGCGTACGCAGCATCGCAGCTACTG
CCGCCCACCCAATGACTGTTGACAGTCGTTGGAGTGCCTCCCACTCTGGATCCGACAGGTGGAGGCAGTCAGCGCGTGCAACATGAGTTGCAGGCGAGGT
GGAGCTTTCCATGGGCACCTCCGCGCTCATGAAAAGGTTCTCGGCTCCTCGTTCGTACAGCTCCGTACGAACGTTCAGGTAGTCGGTCGTTGGACGGACT
ACAAAGTGCTACCAGGTGTAGTGGGCCTACCTTGGCTCACTACTACGGCTTACACGTATGCACACGTGTATGAGGAAGCGTAGGTTTCTTTTACTTGAGT
TAAGTATACTCGAGATCCACGAATATACTTTAAACAAGATAAAGACTCCAAGTAGCGGGTTTTGGTAAAAGATGAGAACTGCTATTTTTGTTTCATGTTT
CTAACTTCCTCTAAATGTAATATTCTAAACTAGAAATCTGCCAACGGCTGGTTGGCAGGATTCTGCTAACATGGAAGTCACTCGTTGGCTAAAAGATACT
GCTTTCAACCAATAGGAATCCTAAATGTGTATGGACCACCCGTCGTGGTGGTCGTAAATGTATGTAGCCATTGATGCACCTTACACCAAGGCCGAGGAAG
TG