Description :
From Genome Similarity Track
Location :
Scaffold_1:2826755- 2828115
Transcript NameFunction/comments
Phypa_INRA-310PPTG_00742hypothetical protein

Sequence
1360 bases(100 bases per row)
TCGAGCAGTCCGCCCCAAAGTATTCTGTGGCTTGTAGCTCGCCGCTTGCCGTCCCGACAGCCCAACCAGAGTCGCAGACACAGCCGAAAATCCTGTCGGC
GTCCCAAGCACCAGAGAACTGCCAGCAAATGATCAAATTACTTGGTGAATCCGATGCTACCGTTTGAAAACGGGCGTACCGGATTGTCTCCGTAGGTTGT
TGGGGGAGAAATGGGCAACGCGTTCTTGGCTGCTGCCATGCTGCGCATACTCATGCACGTTCCTCGGTCAGAACAGTCGTTCGGACAACTCACTGTCACA
TACAACCACCAGTGAGCACAATTTAACACACAATTCTCCACACCAAGATGCGTACTCCTTTCGCATGCAGAGCCTTCAAAACCGGGGAAGCATTTGCAAG
CCCCTGCAGCTCGATCGCAGACCCCCATGCCGGAGCATTCGACAAGAATGTCATGAGCTGTAGTGGTGCTTGTGGGAATAGAATTCCAGGCGAAATTTGA
TGGACATACACCTGCAATGGACGATGAGTTAGACTATCTGCTACATGGTTAATCAGTAGGATACTCACGAGTAGAACAGTCTGGTGACTTGTATTCTGCT
ACATCCGTTGGTGATCCCCAGCCAATGCTGCAAATACAAACCTTTGAGAGAAGCGTACACGTACCATGACCACTGCAATCATTCACATAGGTACACCCTT
CGCCACCTACAGTGCTGCTCTCTTCAATCGTATTGCCTCCTGCGTCTCGAGTGCGTACAATAAAGTTTCCAACCGCATTATTTGAAGACGTGGTAATCTT
GTCGACTGTGAACGAGATTCCGCTTGTCGCTGGGATATTCGCGCCTGCAATCTGTAGTTTAACGGAGCTTGGTGTAGAGATAACAGCGCTACTAGCGCCG
GGAATATTTACCAAAGAACTCGCTGTAATCGTCCCAGCCCCAACACTGTAGTCAGCAGGAAGTACAGCCTCGATATAACCTCCAAGAGGAATTGTTGTCG
AGGTGTCGAGCGTCACAGTCGCTACTGTAAGTGTGTTGGGAGTCTTGAGCAACGGGCGAACACGACCATACGTGAGCGGCTTCTTGACAATCGGTGTACC
TGCCACTGTCGTCAACGCTTCCAAGGCATTGCCACCATTATCGGTGATGGTTACTGTGTACGATCCCCATGTGGGAGTGCAATACTCGACAATGAATTCG
TCGCAGGAGGAGCCAGGATTTACGATGTTTTGCAGCCTAAATCCACGTCCGGTTCCAGGTAATACAGCAATATTTCCCAGCGTCACTCTTGCAATAGTTG
AACTGGCCAGAGAGACAATAGTATTCACGATAGGCAAGTTTGTGATGTGACTCAGGGTAG