Description :
From Genome Similarity Track
Location :
Scaffold_279:28264- 32753
Sequence
4489 bases(100 bases per row)
ATTTTGAATATCGCTTTTGATCGTTAAGTAGTCTGCCAAATCAACGAAAGTGAACGCCAAGAGTGCGTTGGTTTTGGGGAATCCGTATACTCTACGGAAG
AGCACACTAGCATCAAGGTCACCCTAAATGACAATTTAGTGTACGTTCTTAAGGCGTGGGTAGCCCCAATGGTAAATCAGGATGCGATCTTAGGAATGGA
CTTCATGGTCCCGGCTGGTATCTAGATAGACCTGGCGGATGGAACACTCTGTCTCCCTGAAGAAGTTCGGGTACAGCTCTCCGGATCAAGGACCGTCTAC
GATAACCGAGTCTCAGAAGTGAAGATGGGACAATATGCGCATATACTTTCTGTTAAGTGTGTGGAGATACCTTAAAAGGGTCGACTTCGAACAATGGAAG
ATGTGGGTCACAAGACGAAAGCTTTGAGTCACAACTATGACCACCGAGGGGGGGGGTAGGGCGCCGACAGGTGCTGAGGGTGACCAATGTCAAGCTCCCA
CGCGTTGATATAACATGACGATACCGAGATAGGTATGTGGCTGAAGAAGGATAAAGTACCAAGAGCACAAGGTTTCGTCTGGGTGTGCTCTCGAAGATAT
GCTGAGTGGCTGAATCTAGCGTATGATACCACCACCGACCAGGTAGACCCTCAGGTTGACCTCAAGGAGGAGGACGAGGCACCACTGGTGGATACACCAC
AGTATAAGACCCCGTAGCATATTTTGCAGCGTTCGAAGACCCCAGTCTCAATGATGAATGTGTCACACCAACCGTTACCAGAGAGAGAAGAACATTCGCG
CAAAGAAAAGGTGCCTTGACGAGAAGAGACTTCTCAAGAACGAACAGGTCCCAAGGACGGTCCACCTGTAGAGATCGAAGTCGACGAGGAGGAATCCAAG
GCCAACAAATCAACGCAGGACGTTGAGAAATTGTGCACGCTCGAGAGTGGAGGCCTTTGGCCGAATAAATAAACCAAGGATGGGCAATCATACCTGAACT
GGACTTCTCTCTGGAAACTATCGGGTAGAAGGACATACAGATTCCTGATCCGGATGGGGACACGCCAGAAGAGGTAGAACGGCTATAACTGATTATATGG
AAGAAGCGACATCTGTTGATAAGAAGGGGAATACCTTACCACCAGCCGCCCGAGGGCAACATGTGACTTTGATGTAGGAAATGCAAAGCCGATCGCGCAA
CGTGTACGAAAAGTGGCTTCCAATCTAAGGAAAAGCTGGCCACCTTATCAAGGGGCTGTTATCTGCGAAGATTATACAGCATTCTAAATCGCCCTGGGCC
AGCCCAATTTTTATTTTTTTGGAGAAAAATGGGGGGGACATCAGGCTGTGCATCGACTATAGGTTGGTGAATGACCTGACTCAACTTTTGGTGTACCTCT
TGCCTATGATTAATGAATCATTGGAAGAATTGGATGGAACATTGTCGTACTGATCGCTGGAAATGGCAAGTGGTTTTTGGTTGTCGGTATGACTGAAAGG
TCCTGACGAATTTCGACGATCATCGACCCACTGGAAAATGTATGGCTGCGGATGCCATTTGGGCTCAATAATACGCCTCAAATATACCAGCAACTCTTGG
ATAACGCTTTATATGCTTTTTTAAGAATTCCTTAGGAGCAGAGACGGACAGATCAAAAGATTATTCAAGATGGAAGAACCAGAATCGTGTGTCCTCGACC
CTGGGTTAACGTTCATATCTAGATGACATTCTAATTCACGCTGAATCCTGGGATGCTTTGTGTACAAAGGTGGGACAGCTGTTGGATGTGTGCGACTACT
GGAATTTGTCGATCAGCGCAGTCAAGAGTTCGTGGGGATAACGGAAGGTTGACTACGTTGAACATCGAGTGTCTAGAAGGACTGGAGACCCACACGAAGG
ACCTTTAATCTCTGGTTGACCTACCCTAACCTTGACGATGAAACTGAAATCCATGAAATCTTTTCTGTGAAGACTGCATCACGATAACAGGTTAATTGAA
GACAATGCCATGTATGCATCCATTCTTTACGAACTGAGAGAGGTAGATATCCATGCAAGTTGAATCCAGTTAAAGACGGATGATAATATCACTACCAAGG
ATGAAAATGAAGAAAAATGGGCCCGCGTTCAGTAGCCTTTGCTATGGTTAAGCTACTGAACGCGGGCCCACCTTTCTATAGTATTGCCACGGCACCAATT
CTGAGACACTTCGACCCGATCATAGAAGCCGTGATTATTGACTATGCAAGCGAATGGGCCATTTCGGCATCACAAGTACAAGTTCACGAAGGACTACTTA
TGCCGGCGACTTTTATTAGACGGATCCTCAAGGCTAATGAAATTGATTACAGAACTGAGGAAAAGAAGTGTTAGCCTTGCTGCGTATATTGGAGACCTGT
TTTACCATGTTGGTCACCCGGCCCCTTAAAGTTTTGACGAGACATTCGACATTGGCATGGTTGGTAAAATCTGCGGGTTTGCAAAACTGAGCCGCTCTCT
TGTATCAGTGGACATTGGGGATCGTGAAGTGTAAAAAGTTGAAGACCAGGTGCTGGGGCGTTGGCAGCCAGTATTACCCTTCGAGAGAGTGTAGACTCAA
CAATGTCGGCCATTTCCCCTAAGAAGCAGGCAAGGCAGACGAACGACCTACTTACCCCCACCGTGTAATCCGACGAAAAATTGTATTTAATGAGTTTTGA
TGGGTCGGCCCGTGTAAAACAAGGAGGTGGATCTTGTAGCGCCATTGAATGGAGAATTCCAGTAGGGACCACAGTCGAAGCCGCTTTCATGTATTTCGAC
ACGGCTACGGTAAATGAGGCGGAATATGAGGGTAAGTTGCTGGGTTTTAACTTGTTGAAAGCTGTAAAGCGACGGCGATTGATGATCGGTGGAGACTCCA
ATTTAGCTGTGCGGTATAAGTATGGGGAGATTGAGTGTAAAACCTCTGCCCTGGCCCCACTACGAGCCTGGGCTTTAAATGAGCTCCAGTCATGGCCCTT
CCATGGGATACTACATGTAAGTCGAGATTGTAATCAGAGCGCCGACCAGTCGGCTAGTACAGCTTTGTACCAGCAGGAGGGGGTCAAGTCGACGCTGAGT
GAACCAGGTTTGGAAGATATCAACCGGTAACCGGAGTTGCTAGTACCTAAATACCAGAGCCTCTTTACAAACATATTTGCGGTGTGGTAGCGGTTAACCA
TTAGGATATCCGGGGAGACCATGCAAAAGAAGGTGGTGCAAGGACTCCGAGTGGACCGATTTCGAAAGCTGCAAGAAAAATATAGATTTTACGATTTTTG
AAAGCGTATTTGAAAGGAGACAGGAGTGAGCTGTCTATGGAATCTGCTTAATCGTGCCGCAAAATGTTAGGAGATTATGATCTAAGTGAAGAAGGATTAT
TGGTGTACTGCCCCAACCCCAGAGCCGAGTGATAAGGTCAGGATGTGAAGTTCAGGATAATGATACGTGAAAGTCATGAAAGCGACTTTCTTCACCACTA
CTACCCAAGCCTAGAAGGGGACTATCAAGGGACCAGGCGTACCTTCAACTCTTACGACGGTACTGCCACTAGAAATGTCTGTTTCGAAGTGTGCAGAGAT
ATGTGGTTTCTTCCATGAATTATGAGACCGTAAAAGGTGGACCTACCCTACAAGAGAAGAACCCTGGGAATATCGAGGCGACCTATCCCTTCCAAATTAT
ATCGATAGACCATATTCCGTCTCTCCCTCAGTCGCACAAGTGAAATACAGAACTGCTAATGTGGGTTGATTTATTTACCGAGTACGTAATGGCCGAGGCT
AGTGCTTTGCAGATGGCTCAGATGGTTGCTAAGAGATATGAAGAGCGTGTTTTTTCTGCCGGTTTGGGGTTAGTGAGGCGATCCCCCATGATCAAGAACC
GGAATTTGAGTCGGATTTCTTGCGATGTTTCAATCGTATAGTGAGCCAACTTCACCAAGCGACAGAGACCTACCAACCTCAGGCCAATGGTACGGCAGGG
AAGTTGATCCAGAATCTGACCAGGTCTGTCAAATTGTACGTTGCTGAAGTAGGGCTGCGGGACTGGGACTAGGTGCGGAAAGGTTACATTTGCGATCAAT
ACTGCACAATACCGGGTGCGGAAAGAAACGACATTTTATTTGGTCCACAATCGATGCCAGGTCTACCCTTAAAGCCACTGGACCCATAGTGAATGTCCGA
AGTCGGAGTTCTGGGCCCAGAAGGTGGAAGCACCGAATTGAGAGTCAGTATCAGCGATCAAGAGAACAGGTAAGCGAGAAACTGCGATAAGAGAGTCAGG
CTCGAGTGCAAATACTCAACGAAGGGGTGGTCGAGCACAAAATCCGACCGGGAATCCAATTATGGCTCTATCTCGAACGAATAAACGAGGGATGTACCAG
GAAACTGGCCCACCTTTGGCATGGACCTTTCCGCGGTATGGAGCTGGTGGGAGACCATGCAGTGCGTTTGGAATTCGGGGTACTGCTTA