Description :
From Genome Similarity Track
Location :
Scaffold_14:282631- 284151
Transcript NameFunction/comments
Hyaar_Emoy2802631PREDICTED: protein NLRC3

Sequence
1520 bases(100 bases per row)
AGTCGCCGAACTCCACCATTATCATCGCCGTCAGCTCTTGACTATCTTGATCAGTTCGCAAACTACCGAGTCCTGCGAAAGAGTATCAATTAATTGCAAC
GTAACTAGCAATAATGCAGATAGTTTCTCTACCATCCGAGACCGCGTCAAGTTCGACGTGGTACGACCCGACCGACGTCCAGCTCCGTAAGTTCATGATG
GTTCGGTTACAGAGCCATCCAGCATTGGCGCAGCACCACCCAATCTTGCAAAGTACTAGGGACTCCACTGGCACCAGTTTATCACTCTTGCAACGACTCG
AGTGGATGCTTTACTACTGTGCAGGGTCCTTAAGTGAGTACCTGCACCAGCCGTCGCTCGAGCGACGCGTTCAGGGTCTCGTGACGCACTATAAGCGCAA
ACGATCCGAGACGGAGTCGAGTGAGGACGTTGTAGAGTCTGTCCGAGCACCTACAGCCAAGCGACAGAGACCCCAATTAACTATCACTGAAGAAGTAATC
TCCAACAATAGCATACAGGCGAGTGAGTGTGTACTCAACAGTAATGTGGACCTCTTGCGCAACGTGTACAGCTATTTAGAAGGGATGGACGTGCTGCGAT
GCAGATTTGTCAGCAAGTTCCTGTACGTGCAAACGCCGTCGTTAGTGCGGACACTACATATCGACGCGGCGTCCATGTCAGTTACAGCAAGGCAAACTTA
CGGGGACGGGGCGGCGGACGGTTTGAGCACTTTGTTGCATCAGTGCAAAAATCTCACGAGTCTCACGATCTCGAATCAGGTGAACCAGACACATATTAAG
GCAAACGTCGTGTTCCCAAGAGCACTCACCACTTCGACGTATGCATCGTACGGCTACCAATTGGTGTGTGGAGCCGCCGAGGCATTCAGCAATGGAGCGT
GCCCTTTGCTGCAGGAACTGAAGCTCGTCGCTCCATTTGACTTTGCTACAGAAAGCGACGCAGTGATAACGGTACTGCGAGCGCTGACTGATTCCAAACG
AGAGCGCGGAGTGATAAGGACTCCACTGAAGCACCTGGCACTGGATGCGACTTTTCTAGGTGATCGAGGCGTACAGCAGCTCGCTGATCTGTTTGAGACT
CAGAGTGTGTTCTTCGTCCACCTCGAGACTCTGACAGTGCGCAACAACTTCATCGGTGAAACAGGTTGCCGCGATCTGCTTGAGGCCATCGAGCTGTTCA
GCGACCTTCATACGCTGGACCTCAGCCGCAACATCCTCACGGACACGGACGCACTCACACTTGCAGATTTGCTCGACAATTTTGTGATAGACTTGAGCTG
TTACGATTGCATGGAGAGCGACCAGAAGATGACATCACAAGACGGGCAGTTGAGCGTACTGGGACTCGCAAGCCTGCGTACTTTGAAACTGCAAGAAAAC
TTCATCACATGCGACGGCTTTCACGCCATCGCAATTGCATTGGGTGCTCGAGAAGGTTTTCCAGTCCCGACTGGTAGCACCGCTGCTGATTACGATGACG
TGAACAGCGACGTAGAAGTA