Description :
From Genome Similarity Track
Location :
Scaffold_1357:2826- 4025
Sequence
1199 bases(100 bases per row)
ATCATGGGCTCCCTACCGGTCTGGGCTGCAAGGCCCGCACTCTTGAGTACCTTTTACTAAACTTTAAGTTATTTTCAGTCTGACTCTCTCATCTGCCGCC
GGCGGAAAAGTGCAGTGATCATAGACTGGATGACCGCGAGTAGCTCAAAACAATGAGACTTTCCATTCACAGGGTCCCCAGTTTGCCTGTTGGCTGCATG
CGAACCTCCAGGGCTTTGTGGCCTAGGTCACACAACTGTAGCCAAGAGAATATGAATGGCTTACGGTATCCCCATTGCGGTGTTTGCGTCAGACCAGCAC
TTGCGCGGCACGGAGACAGAAGAGAGAGTCAGGAGCAAAGGCAACGGGCGGAGGGAGCTTTATGGGAAAGGTGCTCTCTCCAATATACAAGATAAAATAT
GACTCTTAGTTTGGGCAGATCTGATTTATATTGGGTATCTGTACTGCTTATGATAAAAGTATCTTGGGCAACCTGATAATTTAATTTTGGGTATGCGACA
CGAAAAAATCTAAGAACGGCGTTGAAGTCGAATGGTCGAGAGCGATCTTTCGAGAGGCGCGCTGGCATCTTTAGTGGGAGTCTTGCGCCATATTCACTAC
TGTATTGTATGCTATAGTGAAATGAAGTAAGAATCAAATGATATGTTTTAGGGCATCTGATTGGATAATACAAAGGGCATTAAGAGCCATTCAAAGGGAA
AGGAGCCAGCGCTGCTGGCAGCAATATGATAAGCCGAGGGATGTGAAGGAAGCAGGAATTCATTGCCATCACATCCGAAACTTACAGCAACTACACAACT
ACGTACAATTGCAGCACGCAACAATCCGATTCCAACACTTCATGCCTTAGACGGAGATAATACCTGCTAAAGTGCTCATTATCTTTCAAAATAATATATT
AATCACATTATTTGTAGGGCTCGTTACCGTGTATCTATCTTCGGTATGCGTATCGGGGTATATATTGTGCAAACACCTGCAAGATAGACACTAGAATGGT
TGAATCAAAGTTGAATTCGAAACTAAAATATCGTGACTGACGTGAATCCGGCAGAGCTCGTAGCGGTGGAATAAGCCATCGGCGCATAGATTATCTTCGT
GTCCTGTTCGTTAAAATGCGGGCGATAGCACTTGCTGGTTTTCGTGACGATGTAGACGGGCTGAAAACAACAACGGCAGCAACCAAATAGTTAGCAACG