Description :
From Genome Similarity Track
Location :
Scaffold_116:28259- 33500
Sequence
5241 bases(100 bases per row)
AATCAAATGCAAATTCTCACACCGATCTCAGTAGATTTGCTATATATATATATTGAATGTGGCAGAGGAATTGCTCAATCCTTTTGACATTACTAGCCAT
TTTCAGAGCATAAATTCTTGGGGTGTTCACTGCTTTGTATGGAATGTCCCGTTAGCGTATTAGGATCTGATAGAACCACCATGGACGCAAATATGGTACA
CTTCGCAGTACCATTTATGATTACGTCCTTCCTTTGTATAGGCAGCCAGTAATGTTGCAGCATTCATCTTGTTAAATGCATGCACTTTCCGCCCCCTGTG
GCTTTTCGCACGCAGAATTTCGGAGATCTATGTGGGGGAGTAGATTCCCTCATATGGCCGGCGGCTAAGTATTCGGCGAAGAATATTTGGATTGCTACTA
CTTGTTAATGAGGAAGTGGTCACTGCTTCATGACATAGTACTTTCTTACCTGATTTCAGGTCGATCTCGTGACAAAAACATTTTTCCTTAGGTAAATCGC
ACGGAACTACTTCTGGAAATACATCATTGGAGCTAATTATCGTGGAAAAGACTTGTCATGAAGCAAATTTCAGGATTGAGACATGTAATGCTCAATCATA
TTATTCTCGTCAAGGACACTCTCGGCTATGTATATGCTGCTGAGAACTCGATAGTTCTTGGCAAAGATCATCGCCGACCGGATATCGGTGACGTACTTGC
CTTCCGCGACTAGTACGAAATCTGCTTGACTTTGCCAATATACAGATCGCGCAAGAGCCTTTTGTGTTCAAGCGTTGATACAATGGTTTATTTCCAAAGT
TAACTTCGGAGGCGAAATCAGGTCTTTCATACAAGCGCTTACGTTTGATCCGTCATTGACCAAGTCATTTAATGTCTTGACAATTTGAAGGGGAAATGTT
CCCTCTCATTTCAGAAGTCATATTTTCTTGGTGTTCTCGATACGTATTTGATCACCAGCGATATCCTCTACGTTAGACATTCCAGTCGATCTAGTTCATC
GTGTCGCCAGTGGATAAAAACCGATCCATTGTTCTAGGATGCTGTCCGCTAGGCGAGCCTCCATGACCCGGCCCGACTTCCATTGTTTCTACAGCTGTCG
GTAGCGTGCTCCACAGTATGGTGTTTAGTTACATTGTGATGTTGTGCAGTCGTACTAGCAGCGAACCATCAGTGAGACAATTGCAGTCACTCGTAGTACG
TCCACACGCTTGTGGAAGCACCAAGACGTTTATCAGAAGTCCATTTAATGAATAAGCGACATGCATATAGATTGTTCGACACTGCAAGATGCCTTATGGC
TTGTACCTTTTGACCCAGGGTAACCCAAAAATGACATCGCATTTGTCGTCCAAGTCCAATACGATGAATTTATCGTCATACTGAACCTCTTTTAGCGTAC
AGCGAAATTCCGCTACATGCTACATCACTATCTCGCATGCGCCTGTTTCACGGCGTAACGTCATAATCATTTGGCAGGGGTCTTGCGCCATTGAACTTGA
GATAGCGATTTTCTAGCGGTTGGCGTCGTATAAAGTTGTTAGACGCCCCAGAATCAAATTGGGCACGACGTGAAATATCGTTCTTCAAGGTAATGAGGGC
AACCTCGGTACCTGATGCAGTAAAGCACAATGACTGTGTGCTGGGGGAAGCTCTTGTCAAGAGGCCTGGAGACCCATTTGACGTTGATGGGTCAGTAGGG
TGCTTCGCACCTACTAAACTCGACCTTTTTTTGTTTGTCAATTACGTTGTCGCGATTTGGCAACGGCGTCGAACCCACACCTTGGGCCTTGCTTGGACGA
GTGGCGGTTTTCACGTACCATGGTACGTGGTACTGAATTTGTGCCTTGCATTCATGTGCATAATGCCCTGTATTTAGACATTAATTGAATCTCTTCAATT
TCTTGTATTGGAAACGCGAGAGCTCTCGCTCTCAGCTTGGCGGTGGTTTATTGGATATGGGCTTCCGCTTTCTAACGCCTCAAAGTGCGATTGGAATATT
CAGTTCTCATTGGCTTGTCTTACACTGAAGTTCTCTTGTTCCGAAACCCAAATTGCCTCTTTCAGGGTATTCAATTCCAGGTGAAACGTGCTGGTCTTGA
TAAGACTATCCGTAAGACCTTGCATAAACAGCATAATTAATGTGCGATAATTTAGTGGATTAGCTGTAATGAGACTCGTTACGTTTCGTATGTGGTGTAT
GTAAGAATGCACATTATACTTGCCTTGCTTGAGCTTCAAAGGTTCATATCGAGCCCTGAACATATCTCGTGGCGGTTCGAACGCTTGATTGAGCCAGGAT
TTGAAGACGTCTGATGAGCTGAAGATATATGGGTCGTGCAACTTGAGGCCCAAGGCCCACGTCACAGCTCGTCCTGTTAAGTTCGACTGAGCAAATGCGA
CCTGAATTTTCTCATCGACGATGTGACGAGCCCTTGTGGCATCGCCCAGCTCGACAAACCATTTCTATAAGGATTTTTCTTCACCTCCCTTGGAGATGTC
AATCTTCAAGGTTTCGGGTCGATGCGTGAGCGTAGCCCCGGAGCCAAAAGCCTGCTGCTGTGTCAACAGTTGGAACTGTTGAGCATCCTGTCTTCTCAAC
GGCTCTGTTTGGTAAATTTTTTGCTGGTGAAGCAAGGTTGACCTATCCTGCTCCATGTCAAGTTCATTCTATATGAAGTTGACAATGGCAGAATATTGAC
CGTCTGATCCCAGTGTGGGCAACTCTGCTCCGACGGCTTCTTGGCCAGTCGTCGAAAACATACGTTCGACGGTATCCATTTGGTTTGAATTAAATAAGAG
TAGCTGTTTTCACGCGCGTGCGAAAGTTTTTCTCTTCACTATCCTACATGTTCATCTTGAATAGAACGTCGTGGTCGTTTGGCGGACTACAAAGTGCTAC
CAGGCATAACGGTCACTCGGCGCTTGCACTGACACAGTACAATCTACTTACACTGTCTCGAGACTTCACGTACATGTACGGGTAGAGGAAGGCTTCAATA
ATAAGTAAGAGTAAAAGGTGAAAAGTTGAACTGTATTTATAATAGTTAGTCTTCTTTCATAAATTCCTATTTCTTATAACAATGTCTAAATACGACCATG
AACTGTAACTATCTGCTCACCTCTCATTGCACGCGCATGTAGTAGCTCGGCGTTATTGGTTGTTATCATGACCCTTTTCACCCAATGAGCAGAGTATTGC
TATTGCTGCTGCTATTACCGGCTAGGTAATAAGATAGGGGAGGAGCTCTGGAGCTCGCCCCATGATATAAGCATTTCAGTCCAAATAACTGAATCAAGTT
ACAAAACACTATACAACAGCAGTAGTCATTGAAGATCGAGTATGATGCTGCAAATATCTGAATTAAAACATTACAGTATACTTGGGCAACGCGTTCGGCC
TGTGCTTATAAGCGTCCAGCATTTGCTTACAAGATAATATTCACCTTCGATCTATTTTAAGCCAATCACAAGCGTGCGTCACAATAGTGACCTAGCCAAA
GAGTGACTTGAATATGCATATATACCTATGAGATGGGGGCAGGCTAGATCGCACTTCGTACGGGTAAGCTACACCTAGCCGCGTTATTTACAGACAGACA
GACAGAATCACACACACACAGATAAGTACGATTTAAATGTTCGGCATTCAACCTTGCGCACAGTCACTAATAGCTTCACCATTCAGGCTCGCAATAATAA
TACGATGTCTTTCTAACTTGATATTTACACCGAATATTTTCTTTACGTGGAACAATATAGGAGAGAAAGCTCTGGAGCTCGCCCTTTGATACAAGTAACT
CAGTTCATAGAACTGAATTAAGTTGCAAAACACTATACAGCAGCAGTCACTAAAGATCGAGTATGATGTTGTAAATATCTGAATTAAAACAGTACAGTAC
ACTTAGACAACGAGATTGGCCTTTGCTTATAAGCGTCCAGCATTTGCTTATGTGATCATACTCACCTTTGATTAATTTTAAGCCAGTCACAAGCATCCAA
AGAGTGACTTTGAACATACCTATACCTAAGGGGGTGGGACAGGCTTAATCGCACTTAAAACGTGTAAGGTACACCTAACCGCGTTATTTACTGACAGACA
GAATCACACACACAGATAAGTTAAAACGTTCGGCATTCAACGATGCGCACAGTTACTAATAGCTCCACCTGTCGGGCTCGCAATCATGTAACGGACAACC
CCCGTTACAACAACGACGTAGCGGAGACCGAGAGATTCCCTACATTTATGAGCCGTATCCCATGTTGTTAGGCTACCCCCTTGTTTTTATGCGAGTCTCT
TTTTTTAAAGATCCCCTCCTTGAATACCTGAAGCAGCAAGTGGCGTCATGTAAGGCGCCAGCGTCGATATTTCCAGTCCAGGTAAACTTTTATTTGCGAT
GAATCCACATGCCCAATAAGTCCACTATTTTATTCATCCCCATCCCCCTGTATTTTGAACCCCTTCCGGAGTCTCGTATTTGGTCAGATCCGGAATGTGC
ACGACTCTCACAGATTAGCACCCAGCTCCAGCTGACAGTTGAATAGTTACTACAGAAAATACTTCCACATACTTGTACAGTGGCGATCTTTACCACTGTA
CAAGTATGTGGAAGTACTTTTCGGAGTAAATGTTCAGCTTCAATCTTTGCCGGTCTTATAGGAACCATACAAGCGCCTCTGTAAGCAACAATCCCCTTAC
ATATCGTGAGTCCGTATATCTCGATGTCTGCGTAATACAAAATCGGATGACATAGATTGTCTGCAGTTAATCCTGAGCGATCTGAGTAATCACTGAACCT
CTTTCGGGCTACTATAAGACAGAAATAAAGAAATTTCAAGACGTGGTATGTCATAATCCACCGTCTGTATTACCTCCTGATAGATGCGTACGTCATGAAA
TTGACTTGGTTCCTGGAACCAAATACTGCGTTACAAGGCAGTGGCCTTTACCAAAGGAACAATGTGACGTCATTGACGAGTTTTTCTGTGCTAAGCACGC
GGCGGGAATGGTGCAGGAGAGTAAGTCTCCTCATTCCACACCGACATTTTGTGTCAAAAAACCTAATGGTAAGTGGCGTATTGTACACGCTTATAATAAG
CTCAATGCGGCTACTATACCGCCACAAACACCCATTCCTAGAAAGGACGTTGATGATTATTATCAACTGCTCATGCGAGCAAGTGATATCCCGCTTACAG
CGGTTAGTGGTCCAAGCGGTATGCTTTGGGAGTGGCTGGTT