Description :
From Genome Similarity Track
Location :
Scaffold_16:282549- 287430
Transcript NameFunction/comments
Phyra_76131AlNc14C162G7795
Phyra_76132WD domain-containing protein, putative
Phyra_42402replication factor C subunit 4
Phyra_76134lectin, putative

Sequence
4881 bases(100 bases per row)
TCCAACGTGAGCAGCCAACCCACATGGTACGCTGACAGCCAGCTCTCGCATAGACGTACGACGACACTTTGCCTGTGCGTCCATTGAACACAATTCGACA
TCCCTACCAACACGAGTCAAAGTCAACCACAGCGTCGCCATCCGCAACAAATGTACCACCTCAACCTTGAAAATGTCCGACTCCACAGTCTGCTCCTTCT
CTTTCACTATTGCATGGCAACACCAAGAGCAAAACCTTGTGGGCGCTCACGTTGCAGTTCTCTGTACGACCTCCAGCACTTACCACTCATGCTGCCGCCA
GGCTGCAATCGCTTCTCCAGGAAGAACTGCTCCCTCTTTTTTTCGGTCCAGCGTCTCCTGGCTTCTTTCTCTTCCTCTCGTTGTCGATCGCTTTTAACGC
GCCGCTCATTGCGCGACGTTGGGCCGCTCGGCCCATTCACAGCGAACATCGCTGACAAGAATTGGTCGAAAGCTGCCGTTTCCGACCAATATGGTTTCTA
ATTTCAAAATACAAAAAACGACTTCACTTCCGACTTGTTACATATCACTGTTACAATTGATCGGAGGACCAAATTTATGGTTTTTAGTCCATGCACAAAA
TATATAGTATTTAGTCCCATCAGGTATTATTATAATACTTGGACCAAATTTACGAGGCATGTACCCGACTGACTAGATCATTAAAAAGTCGACGAAGGAT
GGAGCTCGCGGGGCAGTTTGCGGCGCCTTATGGCCAGCCTCACCCCGTCCAGCAGCAGCGCGAGGCGCCCGTGACCAGCATCGATACGGAACACAACGAC
ATGATCTATGACATCCAGCTGGACTACTACGGCAAGCGCCTGGTCACATGCTCGTCGGACAGGACCTTCCGCGTGTACGACGTGTCCAAGGCGATAGTAG
CGAATGGAGACAGCGACGAGCACTCGGCGCCCAAGGATGGACAGGAGCCGCAGCAGGTGCAGCCGCTGCACGTTCTACAGCACGTGGTGCCTCTGGTCGA
CGACTCGTCGGCCCCGATCCATCGCGCGGCGTGGGCCCACCCCAAGTTTGGCGCAGTGCTGGCGCTGGCTGCCCAAGACGGTAAAGTTTACGTCTATCGG
GAGGAGCTGATTCAGCAGGGCACCGGGGGAGCCGGGAATGTGACGGAATGGCGCCTGAAACACGTGGATGACTTCCACTCGCTCGCTGTGCTCAGTGTGG
CCTGGGCGCCGTACGAGTACGGATTGTGTCTAGCTTGTGCGTCGGCGGACGGGCAGGTGTCGTTCCTTACTCGCATGCGCGAAGGATGGGTGGTCTCGTC
CAGCTTCCGCAACTCGGACGAGGGCATGGGCTGCACGGCGGTGAGTTGGGCACCGTACAACTCGTTGGGGTCGCAGGGGGCTCAAGGACCGGTTCAACGT
GTGGTTACCGGGTCGTGCAATCACGCAGTGACTATCTGGCAACTTGTTGCTGTGCCTCAGGAAGGTGGAAATGCTGGCAGTAGCTACTGGGAAGTTGTGA
AAAGTCCTTTGTACGGACATAATGACTGGGTTCGTGACGTGGCGTGGGCACCGAATGTGGGCATCCCGGCGAACGTGATTGCTTCAGGATCGGACGACCA
CACCGTGCGCGTTTGGACTCAAGACGAGGTGGATGGCGAGTGGGAGTCGCACGTGGTCCACAGCTTCCGCGCGCCGGTGTATCGGATAAGCTGGTCTCTT
ACGGGCTCTGTGCTCAGTGTGGCTGCTGGGGACGACGAGGTCACCTTTTGGAAGCAGCAGAGTAACAACCACGAGTGGACACAAATGTCTGCTGTAACGG
ATCAGGGAGCAGCAACAATCTCGAGTAACTAGATGCGAGCAGCAGCTTGTCACTGACCTCCGAGCTGTATTGCTGGTCGCTGCTATCTTACGAATACTAG
GGTCTCTGGTGGGCACGTGTTTATCATCACCGCCTTGCTGTTTTATTTACGGCCATGCCAAGCTGTTACGTTACGACGAGGTATGGTAGACGCGCATAGC
GTAGGATGCAACGTCTAGCAGCTGAAAATGCTCGCTGGCACCATCCACGAGCCGTTTGTCAGCCTCAGCAATGCGCAGACAGATCTTGGCCTTCTGAGCG
TCGTTGAGCTTGTCCAGTGCCAGCACGTCGTCATTCAGCTGCCGCAAAATGGTCAGCACCGGGTATCCAGCCAGCAGAATACTCTCAATGTCCGTCTTCA
TCTTCTCAAAACTGTTGGAGCCTACAGAGACCCAGAACTGCTGCAGCAGCTCCGGTGGAGCAAGGCCAGCGACAGCAATAACATCATCTTGTGACAGCTC
ATCATCTCCACAAAGCTGTTTGGCGCTCTGTAGGTAGTTGATTGCCTTACGCAAGTCTCCGTTCGAACACTCCAGCAGCGAATCCAGCACCGACTCCGAC
ACGTTCACGTGCTCTTCTGAGGCAATAAACCGGACGCGAGACGCCATGGAAACCTTTTCCAGCGGTGCAAAGCGAAATTTGGCGCATCGTGAGGCCACAG
GCTCAATGATGCGGCTCACGTAGTTACAGATGAGGCAGAAGCGCGTGACCTTGGAGTAGTTCTCCATCATGCGGCGCAGCGCCGATTGCGCGTCGCCCGT
CATAGAGTCCGCCTCATCCAGCACGATGATCTTGAAAGGCGGCAGGCCGCTGACAGTGCTGATGGCGCCTTGGGCGAAGCTCTTGACCTTCTCTCGCACC
ACCTTAATGCCTCGGTCATCGGATGCGTTCAGCTCCAGGAAGCGGCCGTTCTTGCGGAAATCCGGGCCGAAGAGCTGACGCCCCACGGCGACAATGGTAG
ACGTCTTGCCCGTACCTGGAGGTCCGTAGAACAGCAAATGAGGCAGCTGTCCATTGGCGATGGATGTCTTGAGGGTCGCTACCACGTGCTCCTGGTGCGA
GATCTCGTCCACGTTCTTGGGACGGCTAATGTGCAGTAAGAAACGGAGGAAACCCCGTCAAAAAATCGCACACATTCAATGCATACGATGATAGTGCACG
TACTACTTCTCCACCCAGGGCAGCACGGGCGCTGGGAGCTTGGCCTTGGACGACGAATTGGAGCTGAACATGAGAATCGTGGAGTGGTTCGCGCCACTTT
TTGCTTTCGTGAATTATGTAACCGGTTACACAAGGGTACGGTGGCCAATTTGACAACTGCAGGACAATGGCGGAGGCCGAAGACACCTTTGTCGTGACAA
GCGTGCGCACTGTGTGCTGTGTGTGGAAGCTCTGCCCCATGTTATTCAGCTCATTCACGCGTTCACAGAAAGTATGTCGTTGGATGCATTGCCGAAGGTG
CTCGAGCGAGGGCAAACGCATCTTTTCTATCAAGCTCTCCGTGCTGTGGAGAAGAGTGCTAGCCTTCTGTAACAGGAAAAGCGTCAGTATCGACTAGCGA
TGCACTTGATCCCAACCAAGGTGACACGGAAAAAGGATGTATTGAAGGCAATACAGGAACTATATGCTCGATATCCTGGCGCTGTGGATTCAACACTATA
TCTGCTGTGTGTGAAATGGCGGAGCTGTCGGTGTTGAAGTGGCTGTACGCTTGCGAACCATTCTTGCTGTTCAAATAGTTCGACTGGAGCGAGGAGACGC
TGTTCATTTCCGCCTTAGAGAATGGTTGAGGAGATGTGGTTCGCTGGCTGGTGAAGCTCTTTCCCTACCACGTTCGAAGTCTAGAGCATACTGCAGGGGA
GGGCACCTCGAGTTGATTAAGTGGTTGATGATGAAACATGCGCAGAGGGATGAACTCTCGCTTGGTTACTCGTTCGAGAATACTGTTGTAGGAGGCCATT
TCAAAACTGCTACGTTGTTGCAGAAAACCTGTTCGTCGAGTTCCCACACCGCACCCACGGCTTCTCCACGGCACTTTAGGTGGCCGTCATGGTTCCACCA
GACGAACGCCAACTTTGGAGATACTGTCACGATGGCAGCAGTTCTATGGGGCACTTTGAGATGGTTCAATGGCTGTACGTAAATGACCCCAAGCTTTCTT
CACGGAGGGTGGTGGATTGCGCAGCGGAACATGGTGACCTGGAGATCGTAAAGTTTCTTCATGCAAGCACTAAAGAAGGATGCACGACAAGAGCAATGGA
TAGAGCTGCAGCGAACGGACATCTTGAGGTGGTGTAATGGTTATACGAGCATCGCACTGAGGGTTGTACGACTGATGCTATGGATTTGGCCGCACGGAAT
GGAAATCTGGTCGTCTTGGAGTGGCTGAGTTCCAATCGCAGTGAAGGCACCTGTCGTGCAATGAAGGAAGCAGTAGCACACAATCACGTTGAGGTCGCGA
AGTGGCTCTACGATCACTACGGGCAAGACTATCCAGGCGTTCTTAGCCGCGAACTTCTCGGTGAAATGGCTGAACACCGCAATGAAAAATGCCGTGGAGA
AGAGGCATATGGCTGGTTGCACTCGCACGTGCAGCCACTCTCCCCAAACGACGCTGCTAGTGCAGCCCGCAGCGACAACATTTTCCGCACTCGAGTTCAT
ACGCACGAGCATCGAGGAGTGCATCACGCCGACCGTCTATTACGCAAGAAACGGCAACAACCACCCAGAAGTGGTAAATTGGTACGAAGATCGCTACGGC
AATCCGCGCAAGCGCAAACACCCGTAGTTTACCAGGAAAAAAAAGGCAAGTTGAAGTGCATTTTCCAGCTCTAAATCGCACTTAAGTCCTTCCATCACGG
TACTTTGGTCCAGTTCTGGTCCAGATCATTGCCACGTAGCAAATCGTCCGAGGCAGACGCCAGCACTTCCTGTCTTCCCTCCATCGAGCATGAGAGTCTC
GCGCATGAGCTTGGGGCTGCTGCTCTGTGTGGCCACGCTTCTCGCAGCGCTGCAGTCCACTCCCGCGAACGGCAAGCGTCT