Description :
From Genome Similarity Track
Location :
contig_36:282541- 283782
Transcript NameFunction/comments
g7470.t1hypothetical protein

Sequence
1241 bases(100 bases per row)
GTCGTGGGCTCCTAACGCAGGAGATAAACGTCGACGAGGCCATGGGGAAGGCGGCCAAGCACGGACATCTGGAGACTGTTCGGTGGCTGCAACGGTACCG
CCCAGAGGCGCGCGTGTCGGTGTTTGTGCTCATCACGGCGGCGGAGTTCGGGCGTCTGGAGATCGTGCGGTGGCTGCATAGCAACAGGACGGAGGGCTGC
ACGTCCGCTGCCATGGATAGAGCGGCGGCTAATGGTCACTTGGATGTGGTGCAGTGGTTACACTACAATAGGGACGAAGGGTGCACCTACGATGCCATGA
CGGGCGCGGCGGAGTTCGGCCACTTAGACGTTGTCAAGTGGCTGCATAACTACAGAGACGAAGGGTGTACAGTGCACGCCATGGATCGAGCAGCAGCTAA
TGGCCACTTGGAGGTGGTCCAATGGTTGCATGAACACGAGAAGAAGGGTGTTCCCGTCTTGCGATGGATTTGGCGGCCAAGAATGGACAACTGGAAGTGG
TGAAGTGGCTACATGAACACAGAACGGAAGGATGTACTGCAGCTGCCATGAATGGCGCTGCGACGGATGGGCACCTGGAAATGGTGAAATGGTTACATGA
GCATCGAGGAGAAGGATGTACAGGTGTGGGTGTGCGCCATGCGGCTGCGAACGGCCATTTGGAGGTGCTGCAGTGGCTCTACAAGCACTACGCGGCCGTG
TTCCAGTTATCGCAGGTGAACATTATGGATGACGCAGCCTCTCGCGGACAAATGAATGTGTTGCAGTGGTTACATGGCAGCAATGTTGAACGATGCACAA
GCGCCGCTATGGACGGCGCGGCGGCAAGGGGTCATCTAGACGTGGTGCAGTGGCTACATGCAAACAGAAGCGAAGGCTGCACCACGAAAGGAATGGATCT
GGCGGCATGCAATGGCCATTTGGAGGTCGTTTGCTGGCTGCACGAGCACACAAGTGCAGGCTGCACGACCAATGCAATGGATCTCGCTGCAAAAGGTGGA
TTCTTAGACGTCGTCGTCTTCTTGCATGAGAATCGACCCGAGGGCTGTACGTCTCGAGCTATGGATCATGCAGCAGATAATGGTCACCTGGCTGTTGTCC
GTTGGCTTCATGAGCACCGCGAAGAAGGCTGCAGCACAGACGCTATGAACGCGGCTGCACGCAACGGCAATTTGCACTTGCTGGAATTCCTCTATTCAAG
CGCACCGAAGGTTGCACGCCGCACGCTCTAGCTCGCGCGGC