Description :
From Genome Similarity Track
Location :
Scaffold_5:282534- 284202
Transcript NameFunction/comments
Hyaar_Emoy2801009PREDICTED: E3 ubiquitin-protein ligase MIB1-like

Sequence
1668 bases(100 bases per row)
TAATCGTGAAAAATGCAACACGCATATTCTTTAGTATATTCTCTACATTTTAAGATGTGGAAAGCTTATGTTTAGTGTGTTTGACCTCGTATTTGTCGCA
ATCGGAGCAAAAACTACCTCGATATATCGACTGCTCGTTCGTTTTGAGCATATACAGTAGCAGTCAGTCGTGCTGCTTATATTCTCAAATATATCCCCCG
CCGTTCAAAATGGACCCATTTGTTGTCGCATCTGTGATCTCATTCTGACTGTACCACCTTTTCATCCCCTTTTACGAATACGGTACAACACCACCTTCCT
CTATTCCTCAATCCGACGACCACCGTGTCATACTAAACACAAGTGACTACTCCCCGCGCACAATCCGTTACATCGCGTCACCGACAGCCATGGAGGCGTC
AGCTATAGAGGAGAACGCTCTGCCCCCTGTCGCTCTTCCTTTGGAAACAGATCACACTAGCAGGGACAACGAGACGGCCGCTGTACCAATGAGTGCGTCC
AGTCATGAGGAAAGCCAAGCGGATGACGAGATGGAGAAAAGTTCTGACGGAGCGACAGAAGTTAAGGCCCTTACAGACGGCAATGATAAGGGAAAAAAAG
AGGAGATGACGTCGTCGAGGCCTGGGACACCTTTGATGACGGACTTTTCGACCCCTCGAGAGGAAAACACGGAGCCTACGACACCTGTTGGGGAACCTGT
CGAACAGACTTTTGTGGAAGTTGGAGACAGGTTCTCTACTGAGGAAAAGAGTGATATGACACAAGAGGAGGAGGAGACAAAAGTGGAGGAAGAGGGGCAG
ATGAGCATGTCTGTGCAGGAGCAGGAGGAGGTGCAGGACGAGGTGCAGTTGCCGTCCGTGGTGTCTGCTTCAGCGGCTGTAGCTGTTGGTGGCGAGAAGA
GTGTGGAGGTTTCTAGTGGACATCAATTGGATGATGAAGTGGAAGCTGCAGTTGCAGCTGATGAGGAGGAGGAGAAGGGGGTTAAGGGGCTGGAGGAAGT
GGGACAGCCGACGGTACTGGAAGGAGAGGAGGTTAAAGTGCAGGAAGAGGTGAAGGCGATGGAGCAAGCTGGAAAGGAGCCTCAGGTGCTGGAGGAAGCG
GACCATTCTATAATGCACGACCAAGCTGTGCCTGACGAACAAGCTGAAACTGAACTTACAGTGCAGTCTGAAGGGAAGCATATGATGCGTGATGAAGTGG
GGCTAACTGTACAGGACGAAGTAGTGAAGTCTACAACACTGGAGGGAGTGGAGATGACCGTTGACGATGAAGTGGAGCCTGATGTACAGGACAAAGTGGA
GCCTAAAGAAGAGGCTGGAGTTGAGCATACAGGACAAGACGAAGCGGCGCCTAAAGTAGAGGTTGGAGTGGAGCATACAAGACAGGATGGAGTAGAGCTT
GCAGTGGAGGAAGCGAGTACCCCGGAACATGGAGTGGAGCTGATGATTCCGTCGCCGAAACGTCCGGTCGCTTTGAACCTGGTACATCACGATATTGATG
ACGAAGCAAGCGACAGCGAAGACGAGGCGGAAGAACCTGCCTGTGAAGACACTGAGGAAGATGCTGACCTGGGCACTCCACTTGGTTATGCCAGCGCTGC
TGGCTTTGGCGAGGGGCACGATGATTTTGCGTCGCATCGCTTTCTGGGCCCTAGCGTGGCTTCCGATC