Description :
From Genome Similarity Track
Location :
scaffold_62:28251- 29641
Transcript NameFunction/comments
Pl_110747dicarboxylate/amino acid:cation (Na or H ) symporter (DAACS) family protein

Sequence
1390 bases(100 bases per row)
TCTTCGATTTGTTCAGCAATAATACGAGCCACGTATCCATCGCCTACGATGTTGCACACTGTCACGAGCCTCCCGAGGAACCAACTGATGGCCACAAGAT
AACTGTAGCTTGCGGGTACTTCTTTGCTAGGGTATATCGTCGTCCATATGGAGTAGATCATCACAACGCTCGAATTCGGAATGGGAGCTGTGCCCATGGA
GCCCAGCACTGACAAGAGCAAAATGAGAACAAGCTGCAGCCAGCCCAGAGGAACCGCGTCTTTCTCAGTTGTAGAGACCAAAAAAACGATGGCACATGGA
AAGTAAATGGCTGAGCCATTCTTGTGCAGAATGCAACCGATCGTCACCACAAACTGCAATAGACTGCGGGGGACTTCGCGGGTGGACTCAACGCATCGCA
GTGTTACTGGTAACGTTACTAGCGACGACGAAGAACCCAATGCAAACATAGCCGCTGGAAGCATAGCCCGCATGAATGGAAAAGGGTTCTTCCTGAGGGT
CAACCAGAGTAAGATGGGGAAGAACACTAGCTCGAAGATAACTATCGAAAGAATTGTGCACAGCACAAGCACACCAACATGCCTTGCCGCTTGACCCAGC
ATTTCCTGGCTCGACAATGAGCCGGCCACGAGTGACATCACAGCAATTGGGCTCCAGTCAATTGCCTTGCTGATTATGCGGAAGAATACCTTGTTCATCT
GTTTGAGCACATCGAGTAAGGGACTACTCTCGCGGGAGCTTGTTTTGATTGCAGCAGCACCAAACGCGATAGCAAATGTGGTCACACTCAGGATCATCCC
TTGCTCGAAGCTCCAGAAAATGTTGGATGGAACGAGCTGGTTAAGGATATCCGTGACTTGCATTGAAACTGTAGTGGCTGCACTTGCTGTGCCATCCGTC
AGAAGAACTCTTGTCGGATCGTAAAACTCAAAGCGCGTCGTGCTATCCATTGAGGCTGCAGAGCATGAGGCGATACCTGAGGAATTATACGTGAAAAAGC
TACCATCCTCACACATGATATCGAAAGACGCCGAAGACGTCTCGGCGACGACACCCTTGGTGTATGGTACGAGGTTGCGCAAAAGCATGGATATCGCGAG
CGACAACGCTGAGCCCAGAAATGACAGACCCGTGAATATTAGAGCCGTGCGAGTGCCAACGATAGACACTTTGCCAAGCAGCACGATGTCAGCCACAGTT
GTGGATAAACTCGTAAACACCATGGGGACCACGAAGCACTTAAGCACCTGCAGGAATACTTTTCCGGGCATATCGACAAGGTTGCTGACATCGTCCGAGA
CGTGGAGATGTGATAACAGCATCCCCAGCAACAAGCCAGCTATAGCTCCTACCATGATCTGTGTCGTCGACTCCCGCAAAAAGGTACATC