Description :
From Genome Similarity Track
Location :
Scaffold_1835:2825- 4063
Transcript NameFunction/comments
Pytul_var.sporangiiferummaker-pug3_contig_1835-snap-gene-0.1Haustorium-specific membrane protein

Sequence
1238 bases(100 bases per row)
TTGTCCCCGCCCGACATGATGTTCACGCGTACGTCCTTGCTGTCCGTGCTCTCGAAGATGAGCTTCACGACACCGTCGCCAGCCTTGGTCCACGTACCGT
AACTGCCTTCGAAAGCCTTGCCGACCGTACGGAGACCAAGCGATTGATCCAACGAACCATCATCGATTTCACCGAGGATCGAGGTAGGGCCACAGATTGG
TTGGATGTATTCCTTGGCCAACGCAGCAATGCCGGTTGGGTCGAACATGGCGACGGCATCGAGACCAAAGTCCGCAATCTTGAGCGCGTAGTCAGCCGTC
GACAATGGCTTGCCGTTGTTGCTCGACGAGTCAATGATCTGGTCGATGATGACTTGGAAAGTCTTACGGATGTCATCACGCGTCTGGAACGCACCCGACG
CGTCCTTAGGCACACAGCTCGAGGTCACAGCAGGGATGTCCTTAGTGAACAGCTCCGAGTTGGACAACGCTACACGGATCACGTCCACAGCGCTTGAAGG
CGACGTGGTCTTGATCTGCTTCACTGCAGCCGTCACACGGTCGATGATGCTCTTGAGTTCCGTACCGCACGTCACTCCTTGGTTGATGAGTTTCGTGAGC
GAGGTCAGATCCGCCGAGCTCAACTTGTTGACCGAGGCGCCAGCGCCCACGGACGTCGTAAAGTTGAGGAACGTCTGGGTGTCCAAGATACTCTCACCCT
TGCTGGTGACCTGGTCCAAGATCTTCTTGATCATCGTGACCACTTCAGCGGCCTGGTTGAGACCAGTTGGCGTTGGAAGTCCTAGGCACGTGGTCACCGC
GACAGGCAAGTCGTACACGACGAAGTCCGACTTGGAAAGCATGTACTGGAACTGAGACTTTGTGGTGTTTGGGAAGCTCACCTCGAGTTCCTTCGCGTAG
CTGACGACCTTGTTGGTGGCAGCGTAAAGCTGCTGACCACACTTGACACCGGTTTGCACAGCCTTGCTGGCAGTCGACAATTGGCCGAAAACACCCGAGG
TCGCAACATTCAACGCGACATTCGCGACAGCAGTAACCTTGCCAATGACCTCAAGCGTGCAGTCCTTGTTTTGAGGGATGCACTCCATGCCACATTGGAC
TGGGTACTCGATCGGGCATTGCGCCCAGCAGGTCGCGATCTTGTCGAACACATAGCCAGCAGGGCAGTTCTTGGTCAAGTGGGACTTGCGGTAGCACGCC
GTGTCTTGCGGGGCGCCAACCTTTGGGCCAACCCAGTT