Description :
From Genome Similarity Track
Location :
Scaffold_872:2825- 3865
Transcript NameFunction/comments
Phymu_g12224hypothetical protein

Sequence
1040 bases(100 bases per row)
ttgaagctgaagctccCGGCGTCTGCGCGTGACTGGTTTAACCAGTTGCCCAAGAGCGTGTCACGTGACTGGAAGGAACTGTCCTCCGCGTTCAAGAGAC
GTTATTGCAAGGCCCGGTCATCGTACTCTGAGCGGTATTTCAccatggagatgaagagTTCTGAGACTCCCTTAAAAAATTTCTACCGTCTGAATTCTGC
CGCCGGTAAGGCCGACATCGATTTCAGGAAGTCATCCAAGCGTCTGGAGAAACATGTTCTGAGATTCATTACCAAGCTGAACGACGCACGTCTGAAGACC
TCGTTGCAAGGACAGAGATTCCGGAGCATCTCAGACTTGGAGTATGCCATTTTGCAGGACGAAGAAGTCTGGCGAACAGGTGATCGAGATATGGCGGTGA
CCAAGCCCCGTGATTTCCGAGCAGACAACATCCCTCGGGGACAGTTCAAGCCCAAGCGGATGCACCGGACTTACCTCGCCAAGGATGCTGTCTCCCCAGA
CTCGGAGGACGATGACTCCGAAGAACATCGACAACCTCTGAGGAACAGTGACGATTCCAGGTCGCAGACCGAAGATTCAAGAAGTCAGACACTGACTGTG
GAGTCAAGTCGCGATACGTGTGGTACGCACACCGGTGCAAGTCCGCCAGCTACTGCCTCGACATCCGTGAATCCAGATTGGACACAAACTCTGACAAATG
AAGTCTACCGAGTGATGGACAACATGGGGTGGCGTCCGCCGCCCCAGTCCCCATCGAGACCGTCAGGGCAAGGTTTCCATCAGACACATCGCGACAACTC
TGGTTATTGGGGCAAGTTCTGCGAGAAATGCCGCCGCTCTGGACACTCTGAGGACGACTGCTGGAAGGATATAACGTGTGACAGATGTCTCGAGAAGGGC
CACCCGAGTAGGATGTGTCGAGTACCGCCCTGCGAGGTATGTGGAAAGACGCATCCTGGGAAGCCCTGTGAAGACCTGAAGAACCTTGAATCCCTCAAAC
AGTTGGCTCGCCAAGGTGCACTCAAGGACATGCCGGATCA