Description :
From Genome Similarity Track
Location :
contig_19:282480- 284108
Transcript NameFunction/comments
g4359.t1hypothetical protein AM588_10000100

Sequence
1628 bases(100 bases per row)
GTCGAGGCGGGCGATCGTCTGGTTCCGCCGCAACTTGAGACTACACGACAACTTGGCGCTGGACGCGGCGATCCACTCGCAGCAGACTCTCAAGGCGGGC
GAGGGCGAGATGGCACTGCTGCCCATTTACATTGTGCATCAGCCCGTGAAGCAGCGCTGCGGACCCGTGAGGTTCAGTTCTTGCTGGAGGCGGTGCAAGA
CTTGGCCGACTCCATTGACAAGCTGCAGGGACGGCTGCTGGTGCTCAGAGGAGACGCCGAGGAGGTGCTACGTGAGATTCTCCCGGCGTGGGGCATCACG
GATCTTTTTTCGAGGCGGGCGTCATGCCGTACGCCGTCGCGCGCGACGAGCGCGTGCGGGCGATTGCAGCGGCTTTGGATGTCACGGTCGCGACGTTCTG
TGGGGAGACGCTATACGACCCGCACGAGATCATCCGACGCAATAACGGTGAGCTCCTACGGACTACGAGCAGCTTCTGAAGATCACCACGATATGCAGCC
GCCGGGACATCCGATCCCGCACCAGAGCAGCTAACCAACGCTGCAAGGTTCACTACGAGCAGCTATTTGCAATGTTAGAACAATTCTGCCACCACAACCC
ACGCCTCGCGAACTCCATCGCTGGAATTGAAACGAGTACATGTACCACGAAGGCGTCACCCGAGCTTTTCGTTGTACCACCGCTCACTGCGTTTGGATTA
ACCCCGCCAGAAACTCACATCTTTCTGTACGGAGGTGAAAGCGAGGCGAGGCGATTATTGAATGCCTTCTCCCAGGACCAACAGCGTGTGGGACTCTTCG
AGAAACCCCGTACTTCCCCAGTGACAATTGACGCACCGTCCACCACGTCGCTGAGTCCGTACCTTGTGTTCGGCTGCCTTAGTGCACGCGAGTTCTTTCA
TTGTATTATGGTCATCCAGATACAATTTCCACAGCGGCCTGGCCAACGCAAGTCACACTGGAAGGACAACTTATGTGGCGCGAGTTCTTCTACTGTACGC
TTGCGGCACACCGAATTTCGATTCACAGGAGCGCAACCCAGGCTGCAAGCAGATCAAGTGGCGCCTGCGACCTGAGAACCATGAGCCGTGCCCTGAAGAC
GGATGCGAACGGGTGAGTGCCACCGATGACGCGGACGAGAAGCTGGCGATGCGTCAGTTGCAGTGCTGGAAAGATGGATGCACAGGCTTCCCGTGGATCG
ACGCTGTAATGCGACAGATTAACCAGGAAGGCTGGACACACCACGCCGGCCGACACGCCGTGGCTTGTTTCCTGACAAGAGGCGTCCTCTATATCTCGTG
GCTACAAGGCGCAATGTACTTTCAGGAGAAGCTCGTCGATATGGACTGGGCGCTAACGTTGGCAACTGGCTCTGGGTTAGTGCGAGTTGCTTCTACTCAG
ACTATCGTCGGGTGGCGTCTCCGTCAACCTTCCCACAGCGGTGGGACAAAGAAGGTCGGTTCATTCGCAAGTATATTCCAGCGCTCCGTAACATGCCAGA
CAAGTTTGTGTTTGAGCCCTGGAAGGCTCCGTTAAAGTACAGCGTATGCTGGGTGCCTCATGGAAAGGATTACCCGTTTCCTATCGTAGATGGGAAGCAC
GCAGTGAAGCGATGCATCACCGGCATGA