Description :
From Genome Similarity Track
Location :
Scaffold_879:2824- 4534
Sequence
1710 bases(100 bases per row)
CTCGCGAAAGCACATTGAATTCCTGAAATCTTGCAGCAAAGTCAGTCGCGACAGCACGCACAGCGATCAATTGGACGCCTGGTGTGGCAAGTTCTTGGTC
GCGGCCACTAGGACCAGCGAGTTATCTAGTGCTCAGCACGCGATGGAAAGTGGGCAAGGGATGCGGCCTTCGAGTGTGCATGGGGCGATGTTTGACAAAC
TGCTGGTCAAGTGGGGGTCCTAGTTCTGCCTCAACTGGATGCTCTGGGGGGCGTTGATCTGCGCAGACGTGCTCGCACTTGCGTGGGCGATCGTGGATGC
CTGATGTCGTTGCAGAGCCGAGACTTACGAACGTATTGAGCGTGGAGAAGTACGCAGATAGGCCAATACCTATTAACGCGTTTAGTCTCGAGCTCTTATG
TCTGCTTGCATGAAGTATAACGAGGAGAAAGTTTTGGTTTAGGATGTTTCATGCTAACTCCATTGAAATAAATGAGCGTTCATCGCTGATGCTGTGTGAC
TCGGCCGACTGGCGTGATGAAACTCACGTAAAGGTCGTTATGCTAATGAACTCGCCTCGAGCCTTCGGGTAAAGCACGTTTTTGTTCAGGTGCACTCCCT
TACCAAATCAATGTGTGGTAACCCGAGCTCGAACTTCAAAATCTATTCCCTTCAGTTTGCGTCGCTCGGCTGAGCAATTTGCCGACTGTGAACTTCCTGA
AAGGAGAAAGTCGAGAATTCTCTTCGCATGCTTCCTAACTATAGCAACCACTCTCGTCCCATACTGGGGGGNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNTGCACAGCTGAAAGCCACG
GGAAAACATAACGAGGCGGTATCTGGAGACGACGAAGATGAAAACTGCGGTGTCGAACCCGACTCCGATGTCCGCTGCACCTTGGGTCTCCGTTCGATGC
GGGAGGCCGACCGCTCGACAACAGCCCACCTCTTCATGCGAACGCTTCAGCTGCAGCACTACGCACCGCACTACGCATCGTTAAATGCGCTCCAAGGGCT
CGCTGTGGTCGGGAACAAGCACACGGAACCGCACGCTATAACGGATCTCTTCTCTGCGCTTCCATACACGCAATCGACCCACACGCTTATCTTGAAGGTG
ACGGGCTACGACGGGCGATGGGAGTTGCGAAAGCGCGATATTAGCTGGCTCGCGTACGCGCTTTTTCACCCGCGCACCACGACCTCCAGTTGGAAGAAGC
TGCAGCTCAAGGTGAACATCAATTTTGCTGTAAGCGTGCTCAAGCAGATGGAGAAAAGCGACAAGACACCGCTGCTCTCTGCGACGAACCTAGCGGTTAT
CTTGGGCATGAACTAGGCCAAGAAGCGTCGAGCGAAAGGCCAACTCGGCGATGCAAGCGCGCCTCGGCCTCGGATTGAACGTGGGAACCAAACGCAGCTT
CGAATGGTGAATGTCAAGAGCGGCGCTGTCATGTTCATGGAGTCAGAGTCGAGCGCCAACGGTGGTCGGAAGCTGTGCACTGTGGCGGTAGACATGGAGC
TGGAGGCCTG