Description :
From Genome Similarity Track
Location :
Scaffold_38:282267- 293635
Transcript NameFunction/comments
Phyra_48136tubulin polyglutamylase, putative
Phyra_48138predicted protein
Phyra_95344FHA domain-containing protein
Phyra_95345Cullin family protein, putative
Phyra_79250U3 snoRNP-associated protein Utp7
Phyra_79251inositol-3,4-bisphosphate 4-phosphatase, putative

Sequence
11368 bases(100 bases per row)
TAACCTCCAGAAGCCAGGGCTTGAGGTTTTCGTCAATCATGACATCGTAGCCGTACAGTTCGAAGCAGTGTTTATCGTTCATGATGATCTTCTCCACACT
GGTTAAAAAAGTCACGCACTTCAGCACGAATCCTGTGACTGCTAAACGATGCCGTAGTTCAATCCATACCTCAGCAAAGACTTGATGATCACAAGCTGAA
TGTCGTAGAATAGCTTGTTAATGCGCTCAGGACCGTGTTTCGACATCATGTAAAGCTTCAAGTTGCGCAGATCCCATTTCCCGCCATGCTACCAGTCATA
CCATACGCGTCAACGGTAAATAAGCATAGATATTTCGTCAGAGGTGGGCATACCTTCTTGTTGTAGTTCTCGGACGTCTTCTGGACTGCAACGTTGGTGA
GGTGGATGAAGGAGTTGGCGATGTCGCTATGGTTGTTCGAGTAGCGCGAATTGGTAAAGCGCGCGAAGCCGCCACGAAACAGGTAGATCTCGAGAGGGAA
GAAAGTTGGCACGAGAGCATAGAGACGCAGATCGAATTTCTTGCCACCAACGAGATACGGGTTGGAAATGTAGCGCTGTACGACGTACGTCTCAACTTGT
TGGTTTTCGGGTCTCCAGCGAAAGTCTGTTCGCCAATCGCTTATCTGACTCAGCTTCGTGAATAGGAATATACCTTTGCCCTGCGCTCTACAGTAGATTG
TAACAAGAGATCCAATCGTAAGCATAATATCATGCAGCGTAAAGCAACACAAATGAACAGTGTACGTACTTGCCGATAGGCTTCATGATCCAGACGCCCT
GGTTGCGCTTGAACTCTTCCACAAAGATGGCGTATTCACCCGGAAGAATGTACGTGACCGGAAAGAAATCATACGAACCCAGGATACTGTCGAGTTCACT
CGTTACGGCATCTTCCGATCTACGACACAGCCACTCGCGTATGTCATACATAGTCACCAAGGACATTTGATGGCAACTATATACCTCGCTTTCTTGTCCA
TTTGCCGCTTCGCGCGCTTGAGATTCTTGATGAGCAAGTCTTTTCGGCATAGCTGGAACAGCAAAGTACGAGTATGCCCCATTCGTTAGGCTCATGTTTC
AAAAACAAATGGGGAAAGTGATACTACCTCCCGTCCATTCCGATAATGATTTACTCGCTGCCCATTCTCGAGGTGAACGGTGTCGAGTAGATCATAGATG
TACTCGCGGTCAGCCCAGTAGAAATCCCAGTCATTCTCCAATGTTTCTTTCCAGCCTCGACGCAGCAGGGTGTCGTAGATAGTGTTGCGAAACGTGGTCT
TGAAGCGCATCACACTGGTACCACCGCCGCTGCTTGTTGCACCACCACTGATAGGGGCGCCTTTTCCTTTTGAGCCGCTTGCTCCACTGCCAGCGGAGAC
GCCAGATCCACTCTGACGGGATTGGGTCGAGCTACTTGGCTCACTGCTGCTGCGAATTTGTCGTGCAGCTCTCGGTGCACCCCCACCGGCGCTGGAAGGA
TTCCCATCGGGTTTCTTGTCTGCAACCGGCATGAGTGTGATCAACCTAGAGAATACTGTTGTTCTTCCTGGTCCAGAGATACCAAAGAGTCGAAGCGCCG
CGCAGGGGCGGTTTTCCGCCTTTGCCTGTTGAGAAAGCGTTTATATATATTGAAAACGTGTCGCTTATCCGATACCTTTCTGGTAAGTCATGGATCAACA
ACACGTTAACTTCGCGATTCATGCGTACTTGACACCACCCATAAAAGTGCGCGGGTCGGGAGCACCACCATTGAACTCGGCGTTTGAGAAATCAAAGCCT
GGATTCTCCTCCTGGAACCTCTCCAGCATCATCTGCTGCTTGGTAGCTTCCTGCTGCATTGGATCCAACTACACAATACAAAATCACATATTTTGTTATC
AGCAACATCCCAGCCCCCCACAGCTCGCAGCAAGACCCACGAACCTCTCCATGGCCAACGAAGACGCTTGGCCAGATGAACCCCTTTTTCATTTTCTGCA
GGTTAATGTTCAGCTCCCCCGAATCTACAACATAAACCAAATCACCATGTCAATTATCTTCATCCTTACCATGTATGGGAAAGACTCTAGACCAACAAGA
CCTCACCAAGCATCCAGTAGCTCTCCGAGATTACCACAGAGCTTTGGAGATCATGCTGTAAAAGGACAAGAGTAGTTTACACGTCACAAATCACGGTAAA
CTCAGTTGCATGTAGTAAAATGGTCCTACATTGAGGAACTTGTCCGCGACTCCGCGTAGCCCCAGCGTCACGTGGTTGGCGGTGATGTCGCACTGAATTT
GCTGGGCGGTGACGCCGGGAGGAGGCTTGATGAAGATGTTCACCTCCTCCATGGACTGCTCCCACTCGTAGACGACGCGGTCTGCGGTTGGGCAACAGTT
AGCAAAGAGAAGAGGTGTAGTGGGGCGGCAAGCACGCACCGTCGTGCTTGAATACGCGGCGCTGGCTGGCGCTCGCCATGGTCCTCAATTGGGATCTGTA
GATTGCGAAGAGGCCGCATGAAATTGCGCTACCTTCGTGCGACACTCCGTACAAGTTCAAGTCAAAGGAAAAGTGTTTCTTGGCTGTTGCCTCTCTCGCC
TGCAACGTTGACGACGTACGTGCACGCGGAGGCTCCAACAGTTTGTTACATAATGCAGCGACTGTCAATAGCTTAAAACTCCCGCCGCTTGAGCTCGATG
TTCTGGAGCCACCATTAGCCGAAGAACAAGAAAATCTTGAGACGCTGGCAGCACTCGTCACCTACTAATCGGAGCCCGCCGCAGTCGAGCAGCAGATTTT
GGGCAGCGACCAGCAACTCGGTCATGTTGGACCTATCCACCGCGGACTCCGTAAGTCCTATCTTTTTGCAAGTCGCCACGCGCGTCTCGCCGAACTGGGT
GTTGATGTATGCAGAAAACGCAAGCTTTTCCTCGACCGACCAGCGAGTAAACACACTGGCACGCATGCTGGGATCGGGAACGAAGGTGTTGCCAAGCTGT
AGGCTACTCACGCCGCGAGCAGCTCCTTCAGAATCGTCTTCACCCTCGCTGCTCCAACGTTCGTAGCGACGCGATCCTATGGAAAGCCGCTGCTGCCTCG
CGCGACGACGCACATGAGACTTGTAAGCGTCAGTGTGGCCTACCAATCGCTCTACTAGCTCGTCGAGTGCGCGGTTGCGCACAGGCATCGTCTTCACAAC
ATCGCGGCACTCTGGGCACGACAGCGAATTACGAAACCAGTTGCTGATGCAGAATCCGCAGAACGTGTGCGAGCATGGCAGCGTCGCACTGCCATGGAAG
TACTCCAAGCACACTGGGCACATCATCAACCGCTCGCATTCCTCTTTCTCATTTTCCCGGGCCCTTTTGGCGGCACTGCTGGGGTTTCCATCCATAGCTG
CGGCTTCCTCCTCAATAGCTCCACCACGGCGTGATCGTTTTCTCTGTTGACTGCTTGGTGTATCCTGTTGTCTGTTCTTCTCCACATTCTCATTCTCAAC
TGATGTTCTCTTCGGACTGGTCCGGCTGCGTTTCTGCGATAAAGTCTGTGGTGGAGGCGTCATCATGTTGACATCAGTTCCAGGAGTCCCTGCCCCGGAC
CGACACCCTGCCCTCGTGAACGCTGGACTCCCGGCGATCGTCACCGCTGACCTCCCAAAACCTGCTCCAGTCATCGTCATCATAACTCGTCGCGGTGAGC
GATGCGGCGATCGCACGGGGGTCGCCGTTCGCCGATGTTGTGGAGCTGGCGGCGGGGTCGCCGAGCGCGCCAGCGCCTTCACCACAATGTGCGAGTGCGC
TTCGTCTGGGAACTGGACAACGAGCCGCACGCACTGCCTCATGGCCGAGGCCAGCACCACCTCATCTCCGTTGTGCAGCTCCTTGCTGCCACCCGACGGG
ATATCCTCGCCATTCACCGCTGTGCCGTTCATAGTCTCCAGGTCGTAGATAAGCCAGCGGCGCTTGCTGCAGCCGGAACGCGCCGTAGCGGCCAGCGACT
CGGTGAGCGGAACGATGCCCACGTGGCGCTTGCTCACGGTGCGCGTCTCCTCGGACGTAGCGATGCTGACCTCGCAGCCGCGACTGCGACCTACACAGAA
GGCGGCGGAGAACTCCCACGAGCCCATCATAATGTTGAAGTGGCGATCACGGGACGCGGGGTCTGCGTATGTGAGTAATATCAACGTACAGGGATCCTCT
CTAAGCTGGAAAGTCGAGGGGAGAGAGCTCGCGGTTGATGCGCTCGCTCTGGCTTCGTGAGGGGCTTGGAACGAAGCGGAGTGAGGTGGGAACAAGAAGC
ACAGAGCGCTGAGCTGGGATGGCGCGTGATACGAGCGCGGTGGACGTGGAGCAGGAGAGCAAGGTAAGTACGCGCCGTCGCTTGGGTGCTGGCTGGGACT
GAGTCGCCGCCCTTTCCTTATGGTAATTTTGACCAATGGGAGGACGGTACGGGCTGAGAAAGTCAAAACGGAGGGTTGAATTTGGATTGGCTCTAATGTA
GAATACTTTGAATGACGAATATTGTTAATAGGAGGTGTATGACTATTGGAAAGTCGAGTCCATAAATTAATTGCGATGTACATGTGGACACTTGACACTT
TACCCCATTTCATGTTGCTTTGGGAGCTAGCACTGTGGGCTCTAACCTTGGAACTGGTGGTCCTCTAACCTTGGAACTGGTGGTCTTACCGAAGACCTGG
CACTCGCAATCCAATTGAGCAGGCTTCAAACATTCAAGCGACAGGAAGTAAGCACATTACGTCACTTTGGAGACGGACGAAACTGCCGCCATCAAAACAG
CCGTACATGTAGCCTTGGTGCACAGTGCTACATGCCGTGTTGCTACTAGCAACACGCGTAGCAACTTGCTACGCATGCGGCTGTCCAGGATCACTGTCTC
CAAGAAAGAATAGTGGCATGCCAACTTGGGGGATCTTGCACCTAGCGATCTTATCAACCAATGAGAAAAGGGGAAAAGAAGGGGAGGGAAAGAGACCTGC
TCAATTCCATTCACACTTCAAAAAGATTAACTGCAGCCAAGGCAACCCAAGCATCCGAGCGAGCTCGAAGAAAGCTTCTCGCCCTCAGCGCCGTCGTTGC
CAGTCACTGTAGTGTCCGTGTTGCCCCTATAACTCAAAAGATCTCGACGCCAATGAGTGGGAAGAACATGATCACGCTCGAGGAAGGCTGGGACCAGGAG
ATCAAGCCCAAGGCCATCGACGTGCTGCTGGAGATCCTGGACAAGGGCTTCGACCAGGTCAAGGTATCGCCCTTCCCACCCAACGCATTCATGCCCATCT
ACACGACGTGCTACAACATGTGCACGCAGCGCTCGCCGTACAACTTCTCGGAGCAGCTGTACGACCGGCACGGCCAGACGTTCGACGCGTACCTGGAGCA
CAAGGTGCTGCCCAGTCTGGAGCAGGCGCACGACGAGTTCTTTCTGCAGGAGCTCGTCAAGCGTTGGACCAACCACAAACTCATGATGAAGTGGATGACC
CGCTTCTTCATGTACCTGGACCGTTACTATGTCAAGCACCACTCGCTCCCGACGCTGGACGACGCTGGGCTGCAGAGCTTCGACCGCATGGTCTTCCAGA
AGGTCAAGGTGCGCGTGAAGGACGCCATGATCGAGCTCATTGAGAAGGAGCGCAATGGAGAAATCATCGACACGACGCTCATGCGCAACTGCGTCGAGAT
CTTCGAGGTCATGGGCATGAAGTCCCTCGACGTCTATCAGAGCTGTCTGGAGAGCGACCTCGTGGCCACCAGTGCGACGTACTACGAGCGCAAGTCGAAG
GGCTGGCTCAGCGANNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNTTCTCGTACCTCACGGACAAGGATCTCTTTGCTGAGATCTACCGTAATCAGCTCGCTAAGCGTCTGCTGAACCA
GCGATCTGCTTCTGCTGACGCCGAGGTGCTTATGATCGGCAAGCTAAAGTTGCGATGTGGTGCGCAGTTCACGGGTAAGATGGAAGGTATGATGAACGAT
CTGGCCATCGGTAGCGACCATCATCAGGAGTTCGAGGGCTTCTTGAAGAAGCACCGCGAGGAAGACTCGACTGATGCTGCCTTGAACCTCGAGTTCAGCG
TGCAAGTGCTGACGACGGGTTACTGGCCGTCGTACCGCATTCTTGAGGTCACGATGCCGCCGCTTATGGTGCGGTGCATGAACCTCTTCAAGGTGTACTA
CGACTCAAAGACGAGTCACCGCCGGCTGCAGTGGGTGCACTCACTTGGTAACGCGACCGTCCGCGCTAACTTCCCCAAGAAGAAATGGTACGACCTCCAG
GTGACGACGCTGCAGGCTGTGGCTTTGTTGCTGTTCAACGAAGGCGAGGGTGCACTTTCGTTTGAGGCTGTGCGCGAGTCGTTGAACCTAACAGTGGATG
TGGTGAAGCGTATTATGCACTCGCTGTCGTGTGGTAAGTACAAACTGCTGACCAAGACTCCGGCTGGCAAGACGATCTCGACCAGCGACCAGTTTGCCGT
GAACCGCACCTTTGCGTCGCCGATGCGCAAGCTCCGTATTCCGATGGCTTCTCTGGAGGAAAGCCACAGCCAAAAGAACGTGGAGGAGGACCGCAGCATA
GCCATAGAAGCCGCGATTGTGCGTATCATGAAGGCGCGCAAAACGCTGCAGCACCAGCAGCTTATTTCGGAGGTGCTGAGTCAACTGGCGTTCTTCAAGC
CTAACCTGAAGGTCATCAAACGCCGTATCGAGGCTCTTATTGACCGAGAGTACCTTGAACGCGACCCCGACCAAGCCAACACGTACCGCTACCTCGCATA
AGCTACTTGCCGACTTGCTGGTTCCCACGAAGAACAGGATCTGGTTCGATGTATGGCGCAATAAAGGTGTCGTTGGTCATGATATCATTATTGACATTGC
CTCAGTCTTGCGGTGCAATTGTGCTCGTGTGCGTGAGTAGGATTGAGAGTACGCATTGACAGGTCCGGTGAAATTGTCTAATGAAAGTGACCGACTGCTT
GTATTACAGTGAGGAAATGCATCTACTTCTTGAAGAACCGGTTGAGCGCCGTGGGCGCGCTCTCGGCCTTTTCGTTCCACTCGCGCTGCTGGTCCTGTCG
CTCTTGGCGCTTCTGCTTGTTGGCCAGTTGCTCGCGGAATTGCTGCTTCTGTGCGTCGACGACATTTTGCTGCTTCTTGCGTAGTCGTCGCGACGGGCGG
TTCTTGCCGCGCATTTTCTTCTTGGGCTTCTTGGCTGTGCCATCTCCGTTGGCGCGCTCCATCTGGAAGACCTTCTGCTGCTGCTCCTCGGCCGGGTCCA
TGTCCACACGACCGATAGCTCTCGGGTCCAACGTGATCATTTCCGGACGAATCTTCTCCAGCAGCGAGCGCACCTCGGACTCGTCGCGCTGCTTGCGGTT
CTCGTACGGGTTCGCCTCGTACGTGTCGAAGTTAGGCTCACCGGCGCCAGGAATCACCACTGAGTTGAAACCCTTAGCATGGCCAACACCGAGCACATCC
TCGAATGGGCGGAAGGCCACACTGCTCACCAGCGATCCTGGAATCTGGTACGTCATGTATGGACGGATAGGTGCGCTCGAGTTGAAGGCGCCCTTCAGCA
CGTGCACGTTGGGACCAAAGCCCACCGCCACGAGGCCGCGCTGACTCACACTCATAGTGTTGGCTGCAGCCGTCAGGTAGTAGCTGTTCAATTCCTGGTA
CTTGCGCAGATCAAAAATCTTCACCTTCCTGTCAGCACCCGCGGTGACGAGATACTTTCCGCTGTTGTCGATACCCATGGAGCGAACTGATAGCACAAAT
AACAAAAACAATAGTCAGCAACACATACAATAGCAACAAGCGTCACACACGTAGAAGAACATACTCGGCCCTTGGTGGCACTGCATCTTAACGACAGCGT
CGGACATATTCGGCGTCCACAGCGTCACAATACCGCTGGCGTGGCCGAGGTTCACAACGGCGTTCCAAGGGTTGAGTGCCATGGTATCACAAAGTCCCTG
CTTCGTGCGGTGCGTGGACACTAGCTTTCCTTCCGTCACGTCGTGGTAGCTCAGTAGTCCGTTGCCGCTCACCGTCGAGAGCAAAAAGTGATAGGGCAGG
AACTCCATTCTCCGCGGCTCCGGGACGGTTCGGATGCAGTGAGCCTCAGCACCGGTGCTGTCATAAATGTACACGTGCTTCTTCTGGGCAGTCGCGAAGA
GTGAGTCGTTGTGCAGGAAGCTCACGTCGCGCACGAGGTCATTGGCCTGGAACTCGCACGTGAGCTTCATGCGCAGCGCGTCCATCATGGCCAGGTGGCC
CTTCTGACTGCCGAGCAGCATGTTGCGTCCGCTGCGCGTGTACTTGACGCGGTACGAGCCGTAGTCCGGGAGGTCCAAGCCGAAGATCTTGCGCGCCGTG
TTGAGGTCCACGTTGTCCGCGAGCTGCTTCTGCGTGAACTTGTACGTCTTCTCAAGGCCCTCAGCCTCCAGGAAACCCACCTGATCGGGCAGCAGGATCT
CCGACTTGGCCGCGGACTCGGCCGCCAGCTTTTGTTTCTCATTGGCGCGTAGCAGCGAGCCTTTGAGCTTCTTGTCGCGGATGTTGCGAATGCGGTGCTG
CGAGACGCCGCCGCCGCGCGTGTACTTGCCCACATGCTTGACGGGCTTGGCTTTCTCTTTGTGGCTCTTGGGATGCTTGGTAGCCACTTGGCTAAGGCGC
TTGGGCGCCTCGCGCACGATCTTCTCCACGTCCTCGTGCTCCGAGCCGCTGTCATGGTGGTCCGCCATAGTGTGTCAACCGCGAGATGAAAATGGCTGGC
CAAAAACCTGCAGTGGTTGGAACGGACAGCGCTGTATTTGGGTAGGGTTCTGTAAGAGTTCTAAATTTAAGATTAGAAGAGTATACTATTTAGGTGGTTT
TCTAAATATGAAGTATACTGTACAGCCGTTGTGTATCTCACGTGAGTTTCGAAAGGTCAATGCTGATGCTGGCTGCGCTACAATGTCGGCGCTAACTTTA
ACTAAGCCCGGGCCTTCCTGCCTTATTCCAGTTCGTGAGCGTATCATGAACGCGGCGGTTTCCGCATCATGTCCACCGAATGCCAGCATTGCGGCACCTC
ATACTCAGACCAATACAATGCGGTCAGCGCGAAAGCCAGATGGTGCCACTGTCGAAAGCACGTCTCTTTACGGGTTATAGACTCCAAATATGACCATCTT
TCACACACAATTTACTTCTCCACTGTATGCTTGACCTTAACCTCCGTCGATTTTCCATCCCACTTTAACTGCACTTTCGGACCTCGTCACATCGCCAGAC
CCAACCCGCGCTTCACAATCGACTGTGCCCGACAGCGCGCACTGGTCTCGTCGGCGTCTAAATATGCGGGTACGTTGCTGGCCCCCTTGGAGCGCCCACA
GAAGCCCCCACGGACCCCCTCCGACCTCTATCGCTAGTTCTGCGTCGCGTGCTCACGCGTGTGTCTTGGATCGTTCTGTGTGCGTCTCAGCGTCGACTTT
TGCGAGGCGGCGGGAGGCACATGTACGCGGCGGTCTTGTTGCTGCTGCTCGCCTCCGCATCGACTCTTCCGGCCCGAGCGGTTGATAAAGGTACGCTGCG
GTAAATCTTCCAGTGTTTGGTCTGTCTGTAGAAGCCTCAGGACGGCTCTGATGATGCGTTTTGGCCGCGTTTCGAGCAGAAGCAGAGAAACTGGACCTTG
TGCCAGCTATTGCAGCGTTGGAGCACCACGCCGTCGAATTAGAGTTTGAACAGATGACCAGGATAGCCAGAGGAGACGTGGCGGCCGACGGCCGAAGTCC
CGGCGTCCAGGACCCCGCAGGAGCCGAGTTAATGCTGCATTTGTTCGACGCGCAGGGAAGACCCAGCTCAGAGTGTTCCGGCAGTGCTGACGACACAGAT
ACGATCGAGATCCCACAGTCGGAGGACTGCAGTCAGGCTGCGAGTGTTAGTGGCGCACTGGCAGGTTCCGGCTCGGCGGAGAACGAAGACGCGGTGCTTG
GGATCACGGTGAGCTCCGATGGACTTGAGATCTCCATCCCTATCGTAGGGGTTGCGGTGGGTTCTGGAGGAATCGACGTCTCTGCAGGCTCTACTGATAT
TTCAGTGGGCTCAGGAGGCATTGATGTCTCGGCAGGCTCAACTGGAGTGGGGGTGGGCTCTGCAGGAATTGACGTTTCGGCAGGCTCTGCTGGTGTTTCA
GTGGGTTCAGGAGGCATTGATGTCTCGGCAGGCTCAGCTGAAGTGTCGGCTTCCTCTCATGGCCTCCAAGTCTCCGTGGGCTCGGGGTCGGATGGACTTG
GAGTTTCTGTAGGGTCAGGCGGTCTTGAAGCGACCGTGGGGTCTGGCGGTGTTGATGCGACGGTAGGATCACATGGCTTGGATGTCTCAGTCGGGTCCCA
TGGCTTGGATGCTACTGTAGGCTCTGGTGGCGTTGATGCGACGGTAGGATCACATGGCTTGGATGTCTCGGTCGGGTCCCATGGCTTGGATGCTACTGTA
GGCTCTGGTGGCGTTGATGCGACGGTAGGATCACATGGCTTGGATGTCTCGGTCGGGTCCCATGGCTTGGATGCTACTGTGGGCTCTGGTGGCATTGGTG
TCAGCGTTGGGTCGAATGACTTCGACGCCTCCGTTGGCTCCCATGGTATTCGTGTTGATGCGAGCTCTGGAAGCATCGACGCTTCTGTCGGATCTAGCGG
AGTCCACATCGCTGATGGCTCGTCAGATATTGATACCTCCATTGACCGCCGTGGCATTCACATTGCTACCAGCTCCTCGGATATTGATACTACGGTCGGT
TCGCAGGATGTTCCTCTTGGAGGCGCTAGCTCCTCACATAGCGACACTTCAGTTGGCTCCCCTGGTGTTCAGGTTTCTACAAATTCGTCAGGTATCGACA
CGTCTGTGGGCTCACAAGGTACCACTACCTCATCAGATGCGGACGTGTCTGGGGGTTCTGACACCACGCAGGTAGTTGTTTACTCGGAGGAACGCTCCAT
TAACCTTGAAGGCACAGGTTCAAACGCTTCGGTTGCAACCACTGAGGAAACTCCCCCGCCCGCGGCTCCGAGCAACTTGACGGCCCCCGCGAAGGACACA
GAGGTGCCAACGGAAGCATCTGCAAATTCCACGGCGGTAGAATCCCAAAGCGGATCGAGTGAGGTCAT