Description :
From Genome Similarity Track
Location :
Scaffold_2:28223- 29635
Sequence
1412 bases(100 bases per row)
TGTAGTGGGCCTACTTTGGCTCACTACTTTAGCTTACACGTGTGCGCGTGTATGTGAGGAAGCGTAGCTTAGTTTAAATTAGAGTTAATTATACTCGGGC
CTCCGTGTATAGATTAATCTAAATAAACGATCCAAATAATGTTTTTGGGTTAAAATGAGAACTGCTATTTTTGTTTTGTTTCTGACTTCCTCGAAATGTA
ATATTCTAAGATAGGAATCTGCCAACGGCTGGTTGGCAGAATTCCAACGATATGCATGTCGCTCATTGGCTAAGAGATGCTGCTCTCAGCCAATAGGAAT
CCTAAGTCTCTATGGACCACCCGTCGTGGTGGTCGTAAATGTATGTAGCCTTTGGTGTGTTTACACCAAGGTCGAGAAAGTCTTTCGAACCTCTAACAGA
CGTCGTGTCTGTTAGAGTTACAAGTGACTGTAGCCACTTGTGCGTGTAACCCTGTTACACCATCCCCCCCTCAAGGTTAGACGCGCCGAGTCACGGCACG
TCAATCAGGAAATTGACCATTCGTCAATTCTTCACGTTGAGAGAAAGAAAACTCGAGCTCATTGCGGAATGAGCTCGCCGAAGAAGACCGCCGTCGAAAC
AGAGGGGAATACCTCCGCCGGGATAGAGACTCTCTCTATACCCGAGTACCTCGAGCGTCACAAAGCAAAGCATGACGCTCTTGCTGCCAAGGCTGCGGCG
GGGACAACTCAACCGGAGATTGTCCTCGAAGGTTCATCTGTAGTCAACGACGCTGTTGACTACGGGGACGGCGACGTGGAGATGGAAGAGGGCGAGGCCT
CTTGTAGCAAGCGCAAGGAGTCTATCGACAGCGATAGTCTCGACCCGCATGCCGGGTCGAGACGCCCTCGTGAAGGAGACGACTCGGACGCTTCGAGCTC
GAAGCGTTCGCGCGGCGAGAGCGACACTCCGCTCTCTGCTGCTGGGGCCTTAAGCTCCCCGCGTGAGGTGGCACCTTCAAGCTCTCCGCGCGCTGCTCAG
GCAGCGCGCGATCCGTGGATGCCGTCTGCGTCAGAGATCGCAGACCGTGTTGGAAACACTGTGCCTCCAAACGAAATCCCGCTGTACGTATGCAGCGGGA
TCCACGGCGATGCTGTGGCGGAGGAGCAGCACTTTGATCCGTTAACGAATCAAAGGCGCGATTACTATATCGGACTCTTTCACGAGCTCCGATACTTCTC
CAGCAAGAAGACCTATTCTCGCAGCAAAGTGCCTGAGTGGCAGGCACTTTGTCAAAGTTGGAATGCTTTTGTTGAGAACTTCAACAAGAAGCCGGCTGCT
TACCGTGAGCGGGTAAAGCACGCCCGTGAACGCTTCGAGACATTCTCGACGCGCGGGAGGTTGGAGCAGCTCCACAGATCTTCTGTGGACGCTGGTATTC
CATGCGCTGTGC