Description :
From Genome Similarity Track
Location :
Scaffold_2:2822211- 2824386
Transcript NameFunction/comments
Phyin_T30-4PITG_01543NADPH-dependent diflavin oxidoreductase%2C putative

Sequence
2175 bases(100 bases per row)
CAACTGTGTCATTATCCAATCAGATCATAGACCACAGTAATGGCACTAACTTCGACGCCACGGCTGCTGGTGCTCTACGGCAGCGAGACGGGTACGGCAC
AGGACGTGGCCGAATTCGTACAACAACGCGCTTTCAACCGACATCTGACCGACACGCAGGTATCGGCTATGGACGAGTTCCCCGTGGCACAGCTGCTGCC
GCAGTACTCGATCGTCGTGTTCGTAGCGTCCACGACTGGCAACGGCGAGGCACCCGAAAACATGCGCCGCAGCTGGCGCAGTCTGCTGCGAAAGACGCTG
GGGTCGCAGTGGCTTGCGGGTGTGCGTGTGGCTGTATTCGGCCTGGGCGATTCCAGTTACGCCAAGTATAATGCTGTGGCCAGGCGTTTACAGGCTCGTC
TACTTCAACTCGGAGCCTTGGAGCTAATCGACCGAGGGCTGGGAGACGACCAGCACGCCTACGGATACTTTGGGGCCTTGAACCCTTGGATGGAGAAGCT
CTGGACTGCAGTTCTGCAGCTGCATCCGCTGCCCGAGGGATTCACAGTTGACGACTCCCCGAAACCAATCGAACCCCGCTACTCTGTTACTGTGCATGGA
GCTGGCGTTCGAGAGGTTCAGGAGGCAAAACTATTGACACCGAGGACGGGAGAGTCGCGATTTTACGCGCCACCTAGCACGACGGTGGGGCGTGAGAAGG
GCATCTACTTGGCTCCTGTCGTGGTGAACAAGCGAATTACCGCCGACGACTGGGGGCAGGATGTAAGACACTTCGAGTTCGATATAAGCGAGGCTTCTTG
TGCTGTTGAAGCAACTGAACCTCCGTTCAAAGCTGGCGATATCGCCGTGGTGTACCCTGAGAATGTGACAGGAGTGGACGACATGCTGAAATATGTCAAG
TTGGATGGAGATACGGTCATTTCGATCTACGCAGCCGACGGCTCGAAGCAGTTCGATCTGCCTTCTCCGATTTCTATTCGTGACTTGTTCGCGAAGTACG
TCGCAATCCTGGAGAATCCGCGCCGAAGCTTTTTCGAAAAACTCTCCCTGTTCGCTGCGAACGAAGAGGAGGTACGGGTTCCAGTACATCGCTTGGTAAG
GAATACTGGTTATACTAATTCGAATGTGCGGCGATAGAAGGAGAAACTTGAGGAGCTGGCTTCAGCTGAGGGTGTCGACCTTCTGTACGAATACTGCATC
CGCGAGAAAAAGACATATGCAGAAGTGCTCATCGACTTTCCGAGCGTGGACGTACCTTTAACGATCCTGCTGCAGCTGATTCCGCGTCAGCAGCCCCGAT
CGTACTCCATCTCATCATCGGCCCTGCTGCACCCTGGGCGCGTAAGCTACGCTTTCTCACGTATGGCTGCTTTTTTTTGGTTACTTACTCTCCCGTCGTC
GTCGTTATTTGACTTTATAGGTGCATTTGACCGTGGCCATCGTGGACTTTTTAACGCCATACAAGCGCCGTCGTACTGGAATTTGCTCGTCGTTCTTCCA
GTCCTTGGACTCACCCAAAGAGCAAAAATGTGTACCAATGTGGATTAAGAAGGGCCTCTTCGAACCACCTAGCTTAGATCGCGACGTGCTACTCATCGGC
CCGGGCACCGGACTCGCCAGCATGCGGGCTATAGTGCAAGAGCGTCAGTTCCTGCGCAAACAAGCACGTGAAAACAGTTTAGGGGCGACCTACCTCTACT
TCGGATGCCGTCACGAGAGCAAGGTACGAGGCTAGCACAAGTGCTCGATGCATACTAATCATCTTACAATTCATTGCCGTTCAGGACTTTCTGTATGGTG
ACGAGCTGCGTGGACTCGTAACTACAGGAGATCTCACTGAGCTGCATACGGCGTTCTCACGCGATCAGGTACACTCTTCACCCACCAGCTCTTGGTGCAC
TATCCTTCTTTACCTAACTTAGTCATATGCTGCAGGAGCACAAAATCTACGTGCAGACGCGTCTGGCAGAGAACAAAGAGGCAATTTTCGACTTCATTAT
GAACGGCGAGGGATCCATTTACATCGCCGGATCTGCCAAGCGAATGCCTACCGACGTCTACGAAGTGCTGCGCGATATCCTTCGGTCAGTAGGGAACATT
CCGTTACTAACGGCCGAGAAGGTGATGAAAACGCTAGCCCGCAAGAAGCGCTACGTCGTCGAATCATGGTCATAG