Description :
From Genome Similarity Track
Location :
Scaffold_160:2822- 5275
Transcript NameFunction/comments
Phyag_g2881hypothetical protein PHYSODRAFT_350187

Sequence
2453 bases(100 bases per row)
CCTTGTAGCATTTTTGACCCTTTACGTATCGCATTGTAGTGTGATCTGCCTGCCGGTGGCTCCCACCCGTGGAAGATTCATTAACTTCTTCGCTTGCCCA
GCCATCCCACTTGCCAAGCTTTGTGTGGTCTTGCTTGACTTCGTTAAAGGCGCAGAGCTTGTACTCGTACTTCTGTTCATACAAAACAGTACAGTACACA
TTCAGCAAAAAAAACCTCCCTGACACGGCAAGTGGAGGTACTACGAACCTCAATACGTTTCTCGATACACTTGTCCTTCAGCGCAAAATACGCGCGATCT
GGACCGTAATCCAtttttgcagcttcacgctTCTCGTTTTGtcccttctccagcttggaGATGTCTGAATCAATTTCCTGCATCACCTTCCGCAATGACT
CCGCGACAGGAAGTTTTAACTCACCGTCTAGCATAGGGCTTCATTCACACAACGAATCGTTAGAGGTCGCAAAAAATTTATCAAGGGTAAGGTGCAACTT
ACAACAAGTAGTGGTAGGCGTAGATCGGAGCGTCCCAGACTACACGTGCTCCCCACATCACCGAGCTGTAGCCATCGTAGACACTGCCTCCACCAAGTCG
ACGGAACCACACCGAACGCGATGGCGACGGGAAGTCTGGGAGTTTGTCTATGACTGTACCTGCAACTTCACGAGTTGACAGCACGTTCCACAAGGTTCTC
GGAGAAAATagcaccacctccatcagCGCGCGGACAGGGGAGATTATGATGCCTGTGGCAAAGAGTAGCACACTATCGGTAAGGGATCACACACACCATG
TTTCGATAGGAAATTACGGTCGTACCGACAGTTCGCAGCGCGTAAAGTCCAATCTTTTTTCTCCCTTCAGCGCCACCATTGAACAGTGGACCAAGGaaat
cttctcgtcgcatTTCTTCCGCAGTGCGAGGGGTCCTCCTATAGAAACACACGCAACGCTTTATCAGAACACCCCACGTATCACCAAATTAACACCAAGC
GCGCACAACTTCTTGGTATGAGCTCGCTTGTTGTGGTTCATGCGCAGGTAATCCGCCAGCGAAATCCGTGTGCCATCCGGCAGCTCAACGAGACTTTTCA
CACTCGGCCTTCCTGAATTCAGCACCTCCGACGCATGTTCATCTTCGGCCGAGTTCACAGGGGCGTCATCATCCGCCACCCGTACGGCGTCTAAACCTTC
AAACTCCAACGCTTCCACAGTCTCTTTCTCCACCGCGTCTGAAAACTGTTGCTTAATTTCTCCATCATTTTCGTGGCCCTctgcctgcttcttcctcgcc
atTTCCATCCTGTACTTCTTTTCCTTCAGCTCTTCCCGATCTTTGTGCACCGTCACTCTCTccttcaacagcttcaatCCCGCCAACTCcttctgcgtcg
tcgcctccGACTCCTGTTCCTCGTGAAAGTACGAGGCAATTTCCCCCTTGATCGCCGCTTGGCGCTTCTCAAAGCCAATTTTCACGACTTGAAGTCGCTC
TTCCGCCTCCTTCCGGAATTTCTCCGCAGCTGCCGCACACGTGTTCGGACACGGCGATTTACCGACAATTTCTTCATCCGATCCGTCGCAACAGTCGCAA
ATGCCGTCATGAATCCGCGAAGTATGGATCTATCAAATAATGTAATGATACTTAGTTATGATTCACACGTTTTTCTTCAATTATTGCAATATTTATCACT
TTTCCAGGGAAGAACCCGTCATTTTCACAGTGGAATCGACTGGAAAGTAAATGAGAGCAGGCAGCGGTGCCTGGTTCGTCCTGgccgtcgtcgcagtcgc
agaATTCGTCGTTCACGCGGTTGATTGGCAGATTTGTGGCCTTCCCGCCAACGACACACGAGAATTGAGGGGACAGAAATGTCGCCTGGTCAGAGGGGGC
TACGCCTCGGATCTGTacggaggcgctgcagacgacgggGGAGAGGCctacgagcagcagcaccaagcgtgTCATGCTGGCCACGTCGCTAATTCTCGGG
ATTTTATATCCAGAGTCCTTCCAGTGGCTTGTTTTTTGTATATACAGGCATCCTCCGTTTGTAGGAGACAACCCCATATAAGAGCGGCCAATCATACTGC
TGCATTCCAGATTTCCATTTATAAGTTCTGACCTAAATTGTAGCAAACATATCGATACATATTAACCGGTAGTGTGAGCGCCACTCATTTTGCTTTTGGA
GATGCCACCCCGACGCCGAGACGCGTTTACTGCCCGTGAGAAGTTGGGCGTCGCTGAAGCATTGAATGCTTCAGCCGACGTGCGATGCGTTATTAATGAG
TTCTATCCTAACCTCAGCGATGAAGCATATGAATCTCGGCGAAAGCACGGCTTTGCAGAAAAGTGAGGAGGGGATTGGTTGATAAAGGTCTTATTTGTTG
GCCAATGAGAGGAGAGGATCAAGTTGAATAGAGGAACGAGAACGAACTAACGT