Description :
From Genome Similarity Track
Location :
Scaffold_19:28212- 31419
Sequence
3207 bases(100 bases per row)
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNCAATTTTACCAATTCAATATAATACTGAATTGGAGGGGCCCTGATGTTGACAACATCATGTTGCAATTGGTATTTA
TTGCAACTGCCACTGTCGCCACCACTGCCATGCTACAGCTACTGCGGCTGCTACTGTCACTGCTACTGCCACTGCTTCAGCCACTGTCACTGACACTGGC
ACTATCGCTGCTGCTCCTACTCCTACCTCATCACTACTTATATTGCTATACTACTCATATTCCACTATTGTTAAAGATATTGCATTTGTTATGCTACCTG
TGGCGCGCGTTACTGCTGGTCACAGGCACTATCTGCTTACCACTACTGCAACTACAGCTGGAGCAGCTGTACTACAGCTACTACAACTACTATTTCACTA
CTGTTAATGATGTCATAGTAATGTTGTCATTGATATTGCTTGTTCGTATCTGCTGCTATCGCTACTGCGACTGTTTATTATCTGCTGCCACTACCGCTAC
CGTTGTTATTTACGCTACAACTACGATCTCAGCATTGATAATGGCACTGTAATGATATTGCTCCTGCTTTCTTTTTCATGCCTGAGAAAGACTGCCAAAA
TCTACTCCATACTGCTTGGCTTGCTGCATAATATCACGGGGCATTTCATGGCTTGCTCAAACTAAATTTATAAATAGATGCCATCTGAATATCGCCGTCC
ACCGTGGTGAAAACGACGCGATCCAAACATTATCGATGATCTTATCGTCCTTTAGACCCTTGTAAATCACTCTCCTCTTTTCCAAATAATGTGTGTGACT
TGTATTGCTGCGTAAGTAATATCAATATGACGTATTGTGTCTTTCACGTATTTTGGCGCGTGAGCTGTTAATTCAGGCGGAGTTAGAGTCATAAAAGGGT
GATCAACGCTTATTTAGTGCTAATTATGCCTAAGATTGTGAGCGCTTCCCCTAACATCCGCGATCAGCATTTGAGAGCTAATCGACGGAGATACGAACAG
AATGGCATGGATTGGCGGATAGGAAACCGCCAATCGCTCTGTTTCCGCCTATTAATAACGAAGGCTGGATTAGCTTATTCCGCCTTGAGTCGGCCTCACC
ATCGCCGCTCCTAATTCGGCCATGGAGGAACGACCCGGAATTAACATGGGAATTAGCTAACGCGGGGCATAATTAAGGTCGATAACGGATTAGAGTTATG
CCAGAATTATCACGGCAGAATAAGTGAAAGGCACAATAATTTTTATTCGGTATATTGCTATTGGAATTGTTCGCCTGCGTCACGATCACTGCCAGCTACC
ACTGCAACTGCCCTACTGTCAATGCCACCGCTATTGCAACCGCTATTAGTTACTGACTTTGAAACTGATATTGTTATCGCTATTTCTGTTACTATTTTTT
TTTTGCT