Description :
From Genome Similarity Track
Location :
contig_265:2821- 3919
Transcript NameFunction/comments
g14432.t1XP_009516631.1 hypothetical protein PHYSODRAFT_344027 [Phytophthora sojae

Sequence
1098 bases(100 bases per row)
CCAGCTCGGCCTTGTTGTCGTATAACGGCAGTTCCACACGGTTGAAGCACGTGTGCACCTTGGGGAAGCCGCGAGTTTGCCCAGGCAACGGCCGCAACGA
GAAGGGGCAAATGCGGCCGTCATAACTGGTTAACCCCTTGAAGCCCTGCACTGGCACGCGCGATGAGCCCGTGGAGAACTGCAGGAATCGTGCACGTTCG
TCCTCCGTGAACGCCTGAAGTACTTCCCAGAACCAGCCAACGACGTACGGGGCCTCGTCGAAACTGGGAGCGACCACGTGTTGCGCTTCCAGTCGGCGAG
GTCGATCTCGGGAAGTCCGCACAGCACGAGCTCAAGCTCCTGGTAGTCGAAGACCAGCAGCGCTTCCTGTGGGACGACCTCAAACAATCCAAGAGACAGA
GCTTGCAACTGCGGCCCGTAGCGATCGAGCATGAGGTAGCGCAGCTTGAGGTGCAGGAACTCTTGTTTGTTGGCGTCCGTCACGGGCTTGTCCCGTCCAT
CAGACACCAAGTCCACAGTCACGACTTCGTCATCCGCTCGTAGCTCCGTGACGGAGAACGTGAGCTCCAGGGCGTCCACGCCGTCATTGTCTCGGATCCA
GATCATGCTCGTGTACACCTCCGGGTCCACGTACTGCAGGTCCGAGAAAGTGATTGGCGTGCCTAGGAAGTGCTTGAGAATGGGCAGACACAGCCGCGCC
TGCATGGTCTGTCCTTCCAGCAGGGCGCGGCCTAGCAGTCTGCCAATGCCCCGGAAGTAGAGCAAGTGGTCGGCCGTGCAGTCTTCAGAGTGCGGGTTAA
TAGCCACGGCCTGCGTGTGTCGGTGGCACGACATAAAGAGCCCCAGCTCATCGTCCAGCAACCTGCCGAACAAGATGGAGAACCATTCTCGCTGCAGACC
TCCGGCGTCGATACCTGCTTCCCCGACGAACTCGATGCGAAGCGGGAAGTGAATGTGCTCGGGCTGAATGCCCAGCAACTGCTCCATGCTCTCCACGAGA
ATGTGTTCTCTCTGCACGCGCAGCTTGATGCGTCCTTCTTCCCACGGCCTCAGCAGCGCGCCCATGCGTTCCAAGAACCACGCGTACTTCTTGGGGAA