Description :
From Genome Similarity Track
Location :
Scaffold_2154:2821- 3855
Transcript NameFunction/comments
Pytiw_DAOMBR242034maker-piw_contig_2154-snap-gene-0.5Major Facilitator Superfamily (MFS)

Sequence
1034 bases(100 bases per row)
CACAAGGTGCGGAAACATGCACGCCATGCTGTGCGTAGCAACCTGCTCGAGCAGCGACATGCGTTGCTCGGTCATGGTCGCGTAGTCGGCGTTGCGCGTG
AGCATCGTGTCGATGCTGAGCCGCAGGTAAGCTTTGATGTGCGACTTCAGACGGCTGAAGCACCTCTCTATGGGTTTACATATTGGTGAGTTGGGGCCGA
GGCGTAGAAGCACAGCATCCTTGAACGCTGGAACGCGGAGCTCGGTCTCGCTGTGCGCAGGCGCGTTGTCGAGCACGATCACAATCTCCTTCTCGCGGTA
GTGCTGCTTGTACCCGTTGCTTGCCTTGACCGCGTTGTACACGGCTTCCACGAAGCCGCGTTTGCTCCATCCTAATGCTGCCCCTCTTGAGGCGGTGCAG
CACAGCACCGTCTGCGACGGACACAGCGCACTGAATCTGGAGGTTCGCTCCCTTCGACGGCGGAAGCTCGACAGTTGCACATTTGCCCTTCGGTGCTCTA
CCTTGCGCTCTTTTATAATCAGGTTAAAATTGGTTCATCGTAATTCACACTGTAATCGCCTGCATCTTGGTGCGCGACAAGGTTGCCGGCAAACACTTCG
CGCTTCTGCTTGTTAATTTCGTTGTTACACGTAGAAGGCTCCATACGCACCTATATAAATACAGTAGAATGTCAACAGCATTAGCAAGATACAAAAGATA
CGCAGCATGCATGTGCGATCATCATCTTCACTGTGTACAGCTTGTCCAGCAGACGGCGGCTGATTGTCAACGTCGAGACGTCGACGCCAAAGTCGAACGC
GACGAAGTTACGCAGCTGCGTGAGTGTGAAGGAGCAATTGTCGTTGATGTACTCCTCTGACGTCTCTTCGATGGCGGGTGTGCACTTCGTGGAAGCCGCG
CGCGCGCCGCCTCGTGGTAGAGTCACAGCTCGGTTCGTCTGGACAACGCGTCAAGCTATAGTGCGGGACATACCGTTGTGGCAAGCCACGACCTGCCAGT
CTTCACGCTGATGGAAAGCAGCGCGGATGCGGCG