Description :
From Genome Similarity Track
Location :
Scaffold_38:28207- 30418
Transcript NameFunction/comments
Pytap_DAOMBR444maker-pag1_scaffold_38-fgenesh-gene-0.19Prolyl endopeptidase

Sequence
2211 bases(100 bases per row)
GACGCGGCATTTAAGGAGTGAACGGCGTGTCCAGGTTCCAGGCGATGAAGGCGTAGACTTCGGCACTCTCTTCGATGACCTTGGCCGTTGGCTTGCCGGC
ACCGTGGCCCGACTTGGTGTCGATGCGGATCACGAGCGGGTTCGTCTGCTGTGGCGAGTTGCCGAGCTTGTGCTGCAGCTCCGCGATCAGCTTGTACGAG
TGGAGCGGCACGACACGGTCATCGTGATCGCCCGTGGTCAGGAGCATCGCTGGGAAGCCGCCGTTGGTCAGGTTCTTGACCTTGTCGCTGTCCGCGTCTG
GCACGTTGTGCACAGGCGAGTACTTCAGCAGGTAATGGAAGTCCTCCGCGACATCCGGGTCACCATAGTCCGTGCGCCACGCATGACCGATGGTGAACTT
GTGGAAACGAAGCATGTCCATGACACCGACGGCACCGACAGCAGCGCGGAAGAGGTCAGGACGCTGGTTCGCACAAGCAGCAACAAGAAGACCACCGTTC
GAGCCACCGTGGATAGCAATCTTCGAAGGGTTCgTGTATCCTTCCTTGATGAGGTACTCAGCTGCGTATTGGAAGTCATCGAAGACGTTCTGCTTCTTGA
AGAGCATACCATCCTGGTGCCACTGTTCACCATACTCGCCACCACCACGCAGGTTTGGAAGAGCGAGAAGGCCGCCAAAGTGCTGCACAAACACGAGGCG
GGCGACGCTGAAGGATGGGGTCAATGAAATGTTAAAGCCACCGTAGCCATACAGGTAGGTAGGCAGCTGTCCGTTCTGCGGAGCGGCCTTGGCCTTGACA
AGGAACATTGGGATCTTGGTTCCATCCTTGGATGGGTAGAACACCTGCTTCGCCTCGTACAGGTTGGCATCGAAGCCCTTGACCTTGGTCTCACGGAATA
GCGTTGGCTTCGCGTTGCCCTCACCGAGGTCTACGCGGAAAATTGAGCCCGGGAAAAGGAACGAGATGAAGTGGTAGAAGAACTCCGACTCCGAGCGCTT
ACTCGCAATGCCGACGGTACCAACGGTCGGAAGCTCAATCTCGTACTGGAACACACCATCGAGGTTGTACACATGgAGTTCGTGGCACACGTCCTTGAGA
AGCTTGAGGATGACGAGGTCACCCTTGACTGGGTACACGCCCTCGAGGACAATCGCATCCTTCTGCTCCGGAATCACTTCCTCCCAAGCTGGAGGCCACT
CCGCACTCGATAAGTCGGCTCGCACGAGACGTTCACGAGGCGCATCAAGGTTCGTGGAGAAGTAGAACACGTCATCCTTGTTGAGGATGTAGCTGTACGC
GGCGTCCATGTTGTCGACGAGCTtCTTGACCGAGATCACGTCCGACGATGGCGACGCAAGGAAATCACCGATCGTCGTCAGATCCGCAAGGTGGATCATA
TTGGCGTTcTtGCAGCCATCATTCAGGTAGATGACCAGAGTCTTACCATCGTCCGAGACTTCAGCCGTGAGCGAGTACGTCGCGTTCTGTGGGTACGCGT
ACACGAGCTTGTCCTGCGACTGAGGCGTGTTGATGGCGTGGTACCAGATCTGGTGGTTCAAGTTGGCGTCGGTTTCCGTGCCGCGCTTGCTGTTCTCCGT
GTCGTCATCGCCCTCTGTGAGCTTCTCTGGTGGTGGGTAGCGCGAGTAGAAGAAaCCCTTATCGTCATGCGTCCAGGCAATGTTGCTGAACTTGACCCAC
TCAACCGTGTCTTCGAGCACCTtGTTGTCGTCGTGCACCGCGAGCACCCTGATCGTCTGCCAGTCCgATCCACCGCGCGCGATACCATGCGCAAAGTAGA
GCTTTCCATCATCGAGCTTGGCCTTGGAGAAGGCCGTCGCACCGAGCGCAGCCGTACCGTCGGTCGAGAGTGTGTTCGGGTCGAGAAGCACGCGTGGCTC
GCTCGTGAGCGTGTCCTGGATGTACAGCACGCTCTGGTTCTGCAGGCCGTTGTTCTTGGCGAACACGTACTTGCCGCCGTGCTTGACGGGgCACGAGTAC
TTTTCGtAGTTGAACAGGTCCGTGATGCGGTTCTTGGTCTCTTCGATGTACGGGACATTCTCAAAGACCTGCTGCGTGGTCTTGTTTTGCGCCTCCACGA
ACGCCTTGGTCTCTTCGCTGTCCGGGTtCTCGAGCCAGCGGTAGGGATCCGCGACCTTGACGCCGTGGAGCTCCTCCACAAAGTCGCTGCGGCGCaCAGC
CGGgTAGGTGA