Description :
From Genome Similarity Track
Location :
Scaffold_1390:2820- 5983
Sequence
3163 bases(100 bases per row)
ACGTAGTACTCTTGCACGATCTGCCACGGCATCGGGTAGAACTGGCGCTGGATCGCCGTCCACGCAAAGTGGCGCAGGAGGCACACGATGCAGCAGATCG
GGATCACCAGCCAGTAGCTGCCTTCGTAGAGCGTGTTCTGGAAACTGCCGTAGTCCAGCGGCGAGAGCGACACGAACGAGCTCGACACGATGATCGTCAC
GGGCAGGTACGCCAGCACGCCGAGGAACCAAAGGATGCCGCCATAGACACTCCACGACATCTGCAGCATCGTGAGCTTCAGATTCGCCACCAGCACCACG
CACGTGAACGAGAGCAGACCGTACTGCACCAGTGGCGCGCTGCCCTGGTTCGACGTGTCGTCGTTGAACGCAAACATGACGAAGATGAAGATCACGCACG
CCTCGTAGACCGCGCTGCAGATCCACTTAAAGAACGTGTAGTTGTTGAAGAGCTCCATGCGCGGCCCCACGTGGTAGAGCTGCGGGAAGTGGCGCCCCAC
ACTCCACGGCACGTCGTAGTCAAACACTCCCAGCACGATGATCGGCAGCGACGTGTACGCGATGTTGTACATCTGGAACGCCACCTCGCTGTAGAACTTC
TGGCCTGACGCCGTCGAGCTCACCATGTAGTAGTACTGCGCAAGCACCATCACGATGTTCTTGTAGAACATGTAGCCCACCAGCACCGACATGCGCTTGT
AATTCAGTCGACCATGGTGCAGCAGGAGCTTCTCCAGAAAGTAGAATTGGCCGATGGCATAGTCGCTCGAGTTCACGGCCTGCATGCCCTCCATGCCACA
GATGCCCACGCCCACGTGCGCGCGCTGGATCATCGCCACGTCGTTCGCGCCATCGCCAATCGCCAGTGTGCGCGCCTGCGTGTTCGTCTTGCGCACGAGT
GTGACCACTTCAGCCTTCTGACTGGGTGACACACGACAGCAAACCACGCCCTCGCAGCTCATGGCGAGTTTCAGGAATTCGTCACGGCAGCGGTCGTTCG
CCAGTGTCACTTCCAGACACTCGCCATCAATCACAACAGCTTGGCGAGACCGACTGCCTGCGTTACCCGTATTTGCTTCCACCAAGTGCGTCAGCACTGC
ATCGCTCGTCGGGAATAGGTCGCAGTTGAGCACAATCTGCTTCATGTCGTTGTCCATGAGCTGACACGCGTATGAGATGTTGATCGCCGTCTCCTGCTTG
TCGCCCGTGAGCATCCACACCTTCATGCCCGCCTTCATGAGGTTGGCGATTGCGCGAGGCACATGGTTCTGCAGCTTGTCTTCGATCGCCGTGGCGCCTA
GCAGGATCAGATCTCTCTCGATCTCAACCATCAAGTCGTCGATGCGGTTCGGCAGCCCGGTCTTCCGCTTCTCGATCTCCTCAAGGGACGAGTTCGCTTC
CTTGAATCGCTGGCTCCAGTTCAGGTACTCTTTCTCGTTGATGCGGCGGCGCGCGATCGTGAGCGTTCGCAAGCNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNCGTCATCGCCAAACGTCTCCAGGTGGTTCATGGTCGCCTTCATCACTTCTGGGTT
GTTCTCGGACTTGGAAAGTAGCGGGTAGATCATGTTGTCCGCGCCCTTCGTGAGAACCCAATACTCGCCGTTCGGGTACTGTGCGACAACCGACATGCGC
TTTCGGTCACTCGTAAACTCGAGCACGTCGAGGATCTTGAATTCCTGGAGCTCCGACTCGGCGCCCTTGTTGTTCATGAGGCTCTTGTGATTGAGGCGAA
TTCGAGCGACACCGAGTCCTCGAGATTCGAAGCTGAAGCCGAAAAACTTGGCTCCAGACACGAGCGCCTGCTCATCAGGGGACGACGCAGAGAATCGAAC
TTCAGAGCTGCCTTCCACGACTTCGGGAATGACTGTCTGGCAGAGACTGAGGTGCAGGAAGAAGTCGGCCTCCGAGCAGCCGGTCTGGGTCTCCTTATCC
AACGCGCTGAACAATCTCGCGTCTTGAAAGTTCACGTACGGAACCTTCCCAGCTGTAACTCCGTTTCCCCCCGAGGACCCCGGTGACGGCTCTTCCGCAA
CGACGACTCCTTTCCGACGAAGTGCAGCGCGACCGATCTCGGTTGTGCCAGTGCCGTACGAGATGCCGTTGATCGAGCACTTGCGGAACTCCATGACGTT
GCACGTGAGGGTGCCAGTCTTGTCGCTAAACACGTACGAGATCTGGCCGAGCTCTTCGTTGAGCCCCATGGAGCGCACAATCATGCGCACGTCGAGCTCC
TCGAAGTACATGTCGATGTCCCACGTCATGAAGATCGCCTGAATGAACATGACCATCGAGATCGTCACGTACAGCGACACGGGGATCATCTGGTACATGA
GCAGGAAGTACGAGCCGGCCGAGATGAACCACTGCGCCACGTATCCGCGATTCGCGCCCAGGTAGCTCGCGTCTGAATTGTTCTGGTACATCCACACGAT
GTGGATCGTCGCCCCCACAGCGCACAGCGTGCACAGGAAGAAGAAGAGCCCGATGATCATCTTGTTCACGGTCTTGTTGATCGAGCTCCACTTGGGGCCG
GCGGTTACAGAGCTCTGCATGATCTTCGTGTCGGCTCCCGTGTTGACAACGAGGCCATAGATCCACTCCGTGTTGCGCAACTGGCAGCCTCGCAGAAGAA
CGTTCTTGATGGACACTGGTGCCTGAACCGCTGTCGAGTCGTCACCAAAGCCACCACTGGATGATGGCGCATGCCGCAGCTGCTGGTGCTTTGGCGGATA
TGCGCTTTGCGCGCTCAGCGTGAGCGTTCCGTCAAAGCGGCCGATCACTTTGTTTGGGTTCTCGCACCGCAGGAAGCCCGTTAAGGAAGCCACCTGCTGG
GTCGTGAGCGCGTGGAGCGTGTTATCGCATGCCTGGCGAAGCTTCAGGTTCGTCTCGCCATCCAGCGACTTGGTCTCGACGTAGCAAATGCCGTTTGGGT
CGCTCGGGTCAACTTCATCGACGGCCAGGATGAGCAGATCTGCTGGCGCCGTCTCGCGGTTGC