Description :
From Genome Similarity Track
Location :
Scaffold_1163:2820- 4026
Transcript NameFunction/comments
Phypl_g12619hypothetical protein PHYSODRAFT_320136

Sequence
1206 bases(100 bases per row)
AAGTACGGGATTTCTCCTTGCGGCGTCACGCGAACAGCGTGGCGGTTGCCCGGCAGGTAGTCGAACGTCGCGTAGTGGAACGTGGCGCGGTTGTCCCAAA
TAGCCACCGCGTTCTTCGTCCAGCTGAAGCGCACCTGGAACTCATGACCCTCTGTCACGTGCTGGTACAGAAGTTTTAGCACCGCGTCTACAAGCAAAAC
ACAGACAGACACACACGAGGGTCAACCGACAGCTCGACaccaagcgcagcagcaagcgactCCGTACCCGACTCCGCAGTAGAGAGCTGCACAATACGCT
TCGTGAACGCCGGGTTCACGTATAGGGCACGGCGGCCGGTCACCGGGTGCGTGCGCACGACCGGGTGCTCGAACTCCACCGGCGGACGGCGAATCGTCTG
GCcactggcagcagccgcagcagcttggggcTGTCGGTCGACAAACAGACGCACAAGTTAGGCTCGTGCACATCTACCACCAGTAACAACCGCTACCATG
CGCTTACAATGCCCGTGTGGATCGCCGTGAGACGCGAGATAAAGTCCCTCATCGGTGGAGTGAGGCGGTCGTACGCCTCATACCCAGACGCCCACAGCGT
GTCACCGCCCACCGGCGGGTTcgtcagcaccttgaagcTCGTGTACGACGGCGGCTGGCGCTCGTTGGACACGTCGCTGTGCCACGCGTTGAACGGGTCG
TACATCTGCCGCTTGAGGAAGCCCTCGCTCGCCTCGACCGAgttctccaccaccagcacctcgtggtGGCCCTTCGGGTGGCCCAAGTTCTGGTGCACGT
GGAGAGGGCCATAGTAGCGcccgagctccagctgctgctcgacgtcgaTCTCCTGGTcgcggaagaagacgacgccgcggtgcgcgatcagcagcgccag
ctcgtcgcgctgTGCATCCGTCAGCTCATGCAGCTGAATACCAGACAGCTCCGTGCCGATCTTAGGGGCCAGGTGCGTCACCGTCGCGTCCTTCAGCAGG
TTCTTGAACGTCGGgtcggccttgagcgcgcggTCCTCCACGGGGATCTCGGGGATCGGCTCGAACGTGGTCTCCGGGTAGACGCTCAGCAGTTCCGGGT
GCTCGAACTTGAagtgctccacctcctggtTGAGCGcgttcttgatggccacggGTTTGACCGACGCAGTTTTATTCGAGTCGTTCTGGTGTTGCGGGGC
CATGGC