Description :
From Genome Similarity Track
Location :
Scaffold_1089:282- 4938
Transcript NameFunction/comments
Pytul_var.sporangiiferummaker-pug3_contig_1089-snap-gene-0.1Callose synthase

Sequence
4656 bases(100 bases per row)
NNNNNNNNNNTCACGAGGTCGTCCTGCGTATCCACCACTGGCACCTCGAACTTTTCGTTCCAGACCGGGTTCGCGCGCGAAAATTTCTGCACCTTGGTCT
TAAATTCGCGCATTCGCGTCGTGGTGCCCCCTGTGGTTGCGCTTGCTGCCAAGTTATTATTGCCGTTGGCTTGGGATTGCTGGAGGAATTTTTTGAACGA
CTGACGGCCCTTGCGCGACACGGCCATGTCGGCGTNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNTGTATAGAGGCTCTTGCTGTATATGGAG
AGGCGCTTGTCAAGTGCCGTGCCGCGTCGACGTGTAGAGATGGGAGGAAGGGGGGATGGCGGAGCGCGCTCTTCTCCGCAATTGGTGCTTCCCACTCACT
CGGGCGACGAGCCGTACGAATGCCGCCTGCGGGGCGTCCGTGGAATTAGTTGTAAATCGCAGCGGCGGCGCGAGTCTCTNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNTGCTCGCTCGCACACTTGGCGAAAAGCGCGGAACCGAACACACGACTTGACTTGGTGTTTGTATGGAATGACCATCTGGCCTGTG
GCTCTTCTCTACCCCCACGTGTTTCTGAGGGGAAGCGAGGGAGGGAGGAAGGGGGGGGAACTTACAGGGAAGAGAACCCAACGCAGCACGGGTTAGGGGA
ACGCGCAGCATCGGGTGAGGTTTTATTCTTCAAGTTGCTGAGAATAGTGTGTTTGTAATGAGGACAAGGAGTGGGACTCTCAATACATTTATTAAGGTTT
TTTTTTGGAGTGAATGCTGTTGGTTTTGCGACTGGCTGCTGAGAGTCCGAGTATACTGAGCCCAAGTTGCTGAGTGAGACCAATGAAGCCTATGGACACC
TCAGACAAGATTATTAATTAACTGGCGCAAACAACTGTCTGCTACTCTGCCGTCGTAATAAACGACAACAACATGTGCACAAGCACGCCTGGAAGAATGA
CACAAACACCAGAGCAATTGAAGAATTATAGCTACTGCCACCAACAGTGTACAAGTATCGTTTGTCAAATGCACGGCGCAGTACTCGTGCGATGCAGTTC
TTCCGTCCTGCCTGGCTGCAACAACCGAGTCGGTGGCGCGTCGGGACTGTTCGGCCAGACTCTGTTTCGAAATTCGCAACATGGCAAGCAAGCACGCGAA
CCTATCATACAGCATATGCGCCGCTTGCGCATGTTGTACAACGTCGAAATGTCTCGAGCGCTCGAAGCAGACAAAACCCCAAATTAGCAAGCTGATTGCG
CCCAAAATATGCGCACAATGAACGTCCTACATGATGGAACGAGCGCAGGCCAAACGCGTGACGACGCAATGAAATCTCAACCACTGCGCAGAGCAGTGGG
GTGCGCGTGCCGACGATTTAGTGACTGATTGCTGTCGACGCATGGGAGCAATCGCTTTCTCGTGTTGTGCAACGCATTCGTGACCAATTTCGACACTTCG
AAAAACACGATCGAGAAAGCCGCTTCAGATGACGTCCTCCGTGTTGACGCTGACATCTTCAATCCTCGACCAATTGCAGTCGATGCGCCGTTCGTGTTAC
TCGTTGGCACCTTCGTACGTGTGTTCGGTCAATAAGAGTAATCCGATGCCCTTTGGTATTGGTCTCGCAGACTCCGTCACTCGTGACAATTCCCAATTTA
GAAAGCAGCTCGTGCCCAAAATATGAGCTCAGTCAACTTGCGATGTGTGTGTTTGTTGTGCGCCTTTCGACTGCATTCGTGACCATTTACGACACCCTAC
GAGAGACAGAGAGCCGCTTTTTGATGACACCCCCGCTGTTTATGCCGACAGGACAGTCGCGACCCTCTTGCACACGTGGATTTTGATGCGCCGAGAGTCA
CAGTCGTCGTCACACTGTCGCTGCTACTTTTTGATAATACATACCTTCGGGACCTGCGCACAAGAGAGCGAAGGGACACAGTATGCTGTTTGGTAGGTTT
GCTGCTGACTTCATCATCTTGTATCCATTTTGCCACACGTATGCGAAAATGGTCCTCGACAACAAGCGGTCGTTTACTCTCAATCGTATCAATATTTGTT
TGCGTTTATATATTTAAACAAGCATGTGCATACCTCCTAATAATCCCCCTACAATCGTCGGTACATGGTCTCGTCGGCGTCCGGGTACGACTGCGAGCGC
AGGAACGACTGCGAGCGCGGCTGCTGCACGGGGTACNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNG
AGCGTCAAACTCGTCGATGAGGTCGATGGACCCGGACCGCTGCGGCACGTACGACCCCCCGCGCGGGCTCTGCGTCACGTTGCTCTCGCTGCTGTCGTCG
TGGAAGCTCTGGCTGACGTTGTTCATGCTCGTGGACGTGAACGTCTGGATGTTGACGTTGTCGCTGCTGCTCGTGCTGTCGAGTGTCGACTGACTCACGT
ACGGCAGGCGTCGCGACGNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNAAGCTGGTTCTCACCATGCTCATGGATATCG
TTCACACCGGCGGCAACAATCNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNCGCTTTCTTTTCACCCTTGAGCTGAAT
CGTGCCGATCTTGGTACTCGCGCAGAACATGAAGAGCACGACTGTCATCAACGCGCATAACGCACCAAAGATGAAATGCATCGCAGCGAACGAGGGCGTC
GCGAGGAACACCACCCCTTCGGTCAAATAAAACACGCACAGCGATAGCGAAAAAAGAATGGGACGCTGCGACGCAGGGAACATCTCCATCGCCGACAGCC
ACGCCACGCTCAACAGACTCAGTCCCGTCGCGATGTACAGCACGAGCAGCAGACCCTGCAGCACTTTGCCGTGGTCACTTGTCGCACTCGCAATCACGCC
ACAGAAAAATGACAAGATCGCCAGGCACGGCAAAAACTCCTTCAGCAGCGTCTTGCGGCGCACGTTGTCCACCAAAAAGACCCCAAACGCGAGTCCTGAA
GCACTGCATATCGCAAAGTACTCGAACCACAACGAGTACCGACTGCCGTCCGTCGACGAGCTGGTCTCTTTCAATTGCTGGCGGTACAAGAGCCCGTGCG
ACATCACGATGCCGACCATTATCTGTAGCACAAACACAAACGAGATGCGGAACGGGAGGTTGATTCCTTTCGTCGCCGAACCATTCAGCTCCTCCTCAAT
CAATGCCACATCCTGTTGCACATTTTCACGCTGACGGAGTCGCGCCAGCACTCTTTTCGCGTGTTCCGTGTGCTTGTTGCGAAGCAGCCACACGGGACTT
TCAGGGATCACTTTCAGGACAATTCCCAACACGATAATGACCGGCGCAGCGACATACAGCGGAAGCATACGCCAGTTATCATTGTAGCTCTTCGACGTGT
TTGTCAAGGTCATTACCTTCGCGTCAAGGTTGGCTTGCATGATCGCGTGCACGAGGTATCCGAACATACTGCCGAGCAAGAACATCACCACACTCTTGCC
ACGCCACCCCTTCGTGCAAATTTCAAAGCTGTACAGCATGTAGTTCATCGTCAACACGGCGAGCCCTGCTGCTGTGAGTGTACACGCAAGAATGATCGTC
ACCTTCGATTCGATAAAGTTCAGCACCATGCTCGCCACGATGCACAGAGCACCAGACACCATGCTCCATCGACGGCCAAAGAAGCGACTCAGCACCAAGT
TGATCAGGACCGCGGCGACCGAAGCCCCAGCGCATGCAGTCTTCAAGTACCCCTTCTGCATCCAGTTCAGCAACTGGGAGCTCTCGCTATCTGACAGCGC
GTGCGTCACAAAATAGTAGAACGACCGGTTTACAAAGTTGTCGCTCGAGTCGTTGACGTAGCCCAGCGCAGCGATGAAGCACGTCATGAAACCGTGCACG
AAACCAGCGACCAAACCAAGAATGATCACCAGTGACGCCGCGACTTCCGAACCAGAGCTCAACGCGCGCGAGAAGCCTCCGTTGTACAGCATGCGCGTCT
GCAGGATACGCATGAACGGGAGGAAGGAAAGCGCGATCAGCGGCACAATAAGGAAGAAGCCTACGAGCATATCGAAGAGAAAGCCCAATGCGATCACGGG
GCGCGTCATCGCGAGATGGAATCCGTAAAAGCCATGGAGCGCCAGTGCAAACTGGCAGATCGAGTTGAGTCCCAAGAAGATCGCGCTCGCGAGCACTAAC
GCCTTGTTCACCGACCAGCCAGCAATTCCTCCAATTATAATGGGAGCGATCATCAGACCACAGACGACGACAAGCATGTACACAATGCCGCGCACGGTGA
GGAGCTGCAGCTTTTGCTTTCGAGCAATGGTCGAATTGCTCACGAAATCTCCCGCACATAAAGCGGCCCAAACGGCGGCGATCACGATAATTAGCCAAAT
CATGTCAGTGAGCGAGAACTGGGTCGTGAACACGTAGTACATCGCCAATGGATGGC