Description :
From Genome Similarity Track
Location :
Scaffold_2046:282- 3658
Transcript NameFunction/comments
Phypl_g14595hypothetical protein PHYSODRAFT_341850
Phypl_g14596reverse transcriptase

Sequence
3376 bases(100 bases per row)
ACCACTTTCCTCCAACCTGCAGCCATCCTGCAGACTCAGCAACATCTCCTCTGTCGACATGACCAACTCACATCGACAGATCGCAGTCTCACTGCTCCTC
GTGAGACAGCATCACGCTAAACCGGTGACGGTTAGCGCGATCACGCCGAAATTCATGTAACAATGCTCCACATTTCAGACCTGCTTCGTCTATCCAGGTC
GGATTGCCATAGCCTCGCCAGTCTACCAGAAATTCACGGAAGATCCGGCCATACCTCGTCTTCTTACCAGGTCGTACATCGGAGATTTTTTCCACCTCAT
ATTCATCCGACCCTAGATCCTGGATCCAGCTGTCTTCAGGCAGCAGTACTTCATCGAAGTCAAGCCGATCAGCTCCGTCGATCGTTAGCTGTGCTTGTGG
GCGAACGGGGAATTCCTTCACCGGTTTCAACTTGGCCACATGCACAACAGGGAAAAGGCGATACTCCGTCCCCGAGATCTCGAGTTTCATGGCATAATCA
CCAATTTTCTCGGCCACCCGGAACGGTCCATGCCACAGGTGTGCGAGTTTTCGAGCATATCCTTCCTTGCCGCAATCTAGATAAAGCCACACTTGAGATC
CGACTCCGATATGGTGTGGCCGGATCTCGTCATTGTGCTGATCAGCCCGATCTGCGATCGCTTCCCGGAATCTCTCGTTCACATTTTCCCGTGCTCGTTG
GTAATATCGCTGGATCTGGTATCGCCACCGTCGCGGATTCCGATCCTGGCGACGGGTACTCCCCACTGGGATTGTAGCCACGAGTGTAGATCTAGGATCC
CAGACATGCACCAAGTAAAAAGGTGTATCCCCGCGGATCCGATCCTGAGCGGTGTTGAGCGCAAACGTGAGCCGCTCGGCGTATTCATCCCAGTCTCGTT
GATCCAGATCCTGGACATACATCTTGAGTGCCCTAGTCACAGTCTGCACCATTCGTTCGGCGGTTCCATTCGCTTGAGGTCGGTACGCCGTCGTAGCTCG
CTGATGCTGCCCCAGGATCTTGTTAAATGCGCGGAAGAAGTCGGACATAAATCCTGGCTCGGATCACTTCGCTAGCTCCAAACCTGCGGACGACGCATTC
CTCGTAAGATTCTGCGATCGTCTGCACGGTTCTTGAAACACTGGCCTTTGCGATCGCATATCCGGTGAACAGATCTACCCAGATCAATAGTTCCGTATTA
CCCTTGTAGGATTTGAGCAGAGAGGGGATGTGATCCATGGCTATGACCTGGAACGGGTAGGTTGCTTGGATGTTCCCTTGCGACTCTCCCTGGATCGTGG
GCCGTCCTTTCCGGGTTTCGCAATCGACACATTCTCCTACATGGCGCTGCACACTCCGATCGAGACCCCGCGAGTGGAAGTGACCTCTGATCCGTTGACA
TGTACGGCCGATTCCCTGATGTCCACCCTCCAGGCTCGCATGGTAATGGTGCAAGATATTCTGATGCAGGGATTCCGGCGCCACCAGTCTCATGAGGCCA
TCTCGATCAGCCTCCGCACGTTTCGTAGGAGGATAGTAGAAAAGCAGATCGTGAAGATCCACCTCACAATCCAAAGCGATGTTACCGCAGTATCTAGCCT
CCTCTTGAGTCAAATCGTCCACCTGTCCAGCCAGATACTTCCTCAACCTCGAGATCCACGCCCCCTCGTCTTGTGCTCGCTTAATCCGCTCGATCCGGAG
GTCCCGCACGAGCTCCTCTTGTAATACCGTGGGTCTCGATCTGGATCTGGGGTTGGTTCTAGTTCGTACAGGCGAGACTCGCACTACCTGATCTTCAGTT
TTCGCCACTAGAACTTCGTCTAATCGGTTCAACGTAATCAGATCTTTCTTCTCGGACTCGTCCTCAACTTCGATCCCGTACTGACGCTGGAGGGCTGCTC
CAGCCAGGCTATCTGCACTACCGTTCCAATCACGTTTCACATGGACCAACTCATGATCTAGCCATGCCTGTAAGCGATCTAGCGCCCTCTGCCTCAGGGG
CGTGAGACCCGGTGCTTTGCAATTGATCTCGCCCCTCATCTGGCGAACCACCAGGTTTGAGTCGCCATAGATCACTACGCGTCTCCAATCTACCACTTCA
AGAAGATCTAGGCATAGCAGGAGCCCATGATAATCTGCCTCGTTGCCGTCAGACTGTTGGCATAGCATGATCTGGCCTTCAGCACTGCCATTTCCACATG
ATCGCACTGTAAACGCCCCCTCCTCTTTTAACTCGAACAAATCCATCGAAACTCAGCACGACCAGTTCCTCGTCATCGGGATCGGGGCTTGGATCTTGCG
TCttgtctccttcctggggGAGATCGCGATCAGGGTCTTGTCGACCTCAGATCTGGGCGTGATGCTGGCAGTAAGCGCTCCCAGGATCGAGTCTTCTCCT
ATTGAGCATCGTACGATCTCGAGCGTCCAAGGCGACAACAACGCTGCCCATTGACCCAACCGGCTCTGGAGGCCAGCGGATCTGAACAGCCATGCTAGTG
TTGAATGCCGAGTTAGGATCCGGACGGGTCTACCGACCAACAGATTATAAGATTATAGTTGAGATCCAGGACCCGCAATAGCGCCAATacctccttctcg
accaCTCCATAGTTCAACTCGTTCGCTTTGAGCGTACGGCTCACGAAAGTAATCGGATAGTAGACCCTGTCGTACTCCTGCATAAGGGCTGCTGATATAG
CCCAATCGCTGGCATATACCACGACTACAGCCTGGCGATCCGGGTCAAAATGCCGCAAcacgggcgtcgtcgcgatcttctccttcaacCTCTTGAACGC
CCGGTGCGCATGGACCCACCGTCTGTTCACATCGGAGGAGTCTTGTGCCACCTGATCTGCTGCCACCACACCTCGAGCTTCCAGATCGAAATCTGTGGTG
TCCCGATCGGGGGTCTCCGCTTCAAGGAGCATCGTGATCTGGTCACTGGCCTGCTTCTTAGTCATGGCGGCGAAATCTACCTCTCGCAGCTCGTACATCA
TTGAAGTGTAGATCGCATAATCTTCGATAAAACGGCTATAGTAGTTTAGGCTGCCTTGGAAGGATTTGCATAGATCGTAGTGACGCCGGAAATGGCAGAT
CAGTCAGCGCGGCCAGATCCTTAGGCTTCGCCTCCAATCCATCCTTTGACACGCGATGCCCAAGGTACTCCACCTTTCTCATACCGTAGAAGCTTTTCGC
CACGCTGATCGACATGTTCCACTTATCGCACGCCTCCAGTAAGGCGTCCACCCGATCGCACAACTGGTCCATGATCTAGCTGGTACCAGAATGTCGTCGA
TATAGGATCTGCGTCCTAGCACCGACGATTTACCCGGATCTTCAGGCTCATCTGCTTCAAACAGATCCGCTAGTCC