Description :
From Genome Similarity Track
Location :
Scaffold_1452:282- 2584
Sequence
2302 bases(100 bases per row)
TCGAAACGTTGTCGGTCGATGAGTTTGATCACTCAATGAAGAATGGAGACCTTTCAGAGGTTGTGGTCATTCGACCCGACATCATAGAGTTGAACTATTC
TTCAATTTTGGATGAAGCCGTTCCGGAGGACACAAAAGCAGCACCCAGCGCGCTTAGTGGGTCATAAATATTGAAAGACCCTCATGATATCTTTTATTCC
TTAGTCCAGGAATTTCAAGATGTGGTGTGCCGCGACCCACCCTCATTTCTACCTCCAGATAGAGGTGTCCGTCGTGCAATTGACTTAGTTCCTGGGACGA
AATACTGTGTCACACGACAGTGGCCCTTGCCTAAGGAGAAATGTGATGTCATTGATGACTTCTTCCGTGCTAAGCACGAGGCAGGAATAGTATGTGAGAG
TAAATCTCTACATTCGACACCGACGTTTTGTGTTAAGAAGCCGAACGGCAAGTGACGTATTGTGCATGCTTCTAACAAGTTTAATGCGGCTACGATTCCG
GCACAGACACCCATTCCTCGAAAGGTTGTTCTTCAAAACAACATGGTTGGTTGTACTATGTATAGTGCAATCGACTTGGTCGATGGATATTATCAATTGC
TCATGCAAGCGATTGCTATTCCGCTTACAGCAGTGAGCACCCCGAGTGGTATGCTATGGGAATGGCTGGTGATGCCCCAAGGGCTGTATAATTCTCCGGC
AACATTTAATCGTCTGGTGACGCAACTTTATCCCCACACAGGGATTACGCACAGACGTACTTTGATGACATTTTTGTCCATAGTCGTGCCGAAAAAGGTC
GGTCAGATGTTGACAACCACATCGGTCATTTGCGAGCCGTGCTCGAGTGCATGCACACTAATAAATTGTACGCCAACGCGTCCAAATGCATTTTCGATGC
AGAGGAGATTCCTTTTCTCGGCTGTTTCATTGGTAAGCGCGGCCTTCGAGCGGATCCCGCTAAGTTCAAAGCTATTGTGGACTGGCCGATTCCTAGGAGT
CAAAAGGACTTGCGTAAGTGGATTGGCCTTGCCAATTACTTACACAAATACAGTAGAAATTACGCTGATATGGCTCGGCCATTAACTGATCTCCTTAAGA
AGGACACAGATTGGCGCTGGGACAACACCCATGCTGAAGCATTTCGGTCAATCAAGGAGAGTCTCCTTCATGCTCCCATTTTGGCGTTGCCAAATCCTGA
GTACCCTTTCAGTGTTGTCTGCGATGCATCCGACGTGCCATAGGCAGCGCTCTATTACAATCAGATGCTGCAGACCGCGAGCGAGATATCGCATTTGAAT
CACGTCAGCTGAAAGCTGCTGAAAAGAACTATCCAGTCCATGACAAAGAGCTACTTGCTATGAAGTATGCGCTCGTCAAATTTAGAGTCCATCTGCTTGG
CTTCAAGCCATTCGTCATCTATACGGATCATGCGTCATTACGCACGGCGAAACAGTCACCTCAACTCTCTCAGAGAATGGCTCAGTGGCTTACCTTCTTT
GCGGAATATAACTTCGAGGTGAAGTATAAGCCAGGCAAACAAAATGTGTTGGCAGATGCCCTCTCTCGCCTTCCGGATTATGAGCGTGCTCATGTCACGA
CTTTTTCGTCTCCTATTGAGGAGTTAACTCGTGTGGTACATTCACGGGATTCTCAGTGTGTGGCATTGTTTCATGCCCTTGGGAGTGAGGAATACAAGGA
CTCATTCAATTATCGGCACGCTTGCGGGCCAGCATACATCGATATTCCATCAATAATGGCCTCTTGTGCTATCGCACAGATGTAGCGGATACCGCTCGCA
TTGTTATGCCTCACAATGAGGATCTAAAATATCGAATCCTCTTTGAGGCCCACGATACTACCCTCAGTGGGAATTTGGGCCGGGAAAAGACTTATGGCTC
TATGAGTCAGCCCTACTGGTGGCCCAAACTCTACAAACGGGTGAGCACATACGTGCGTACGTGCGAAACGTGCTAGCGGGTCAAACCCTCGGCACATTCG
GCTGCGCCACTCGCCAGTTTACCTGTGCCCACGGGATGTTGGGAGTCCATCAGTATGGATTTTGTGTTCGGTCTTTCCAAAGACTGTGACGGCAATACGG
GAATCGTGGTCTATGTTGACCGTTTAATCAAGATGGCTCACTTGGCGGCGGTGCCGGATTCCATCGATGGCAAAGGTAAAGCTATGCTGTTTATCGATCG
TGTGTTTAGTCAAAACGGGTTGCCGCTAGCAATCATCTCTGATCGCGACCCTCGCTTCACAGGCAAGTTTTGGACTTCCATCTTCAAGGTGCTTGGCACG
CA