Description :
From Genome Similarity Track
Location :
Scaffold_1588:282- 2017
Transcript NameFunction/comments
Pytap_DAOMBR444maker-pag1_scaffold_1588-snap-gene-0.1ATP-binding Cassette (ABC) Superfamily
Pytap_DAOMBR444maker-pag1_scaffold_1588-snap-gene-0.0ATP-binding Cassette (ABC) Superfamily

Sequence
1735 bases(100 bases per row)
GTGCACGCTGAGTTGGTTGGGAGTGACGTACACAGTCACAAGAGGTTCCAAGTCATAAGATCATGGGGAAAAAGTGATTCTGAAACAAGCAACTGGATGG
TGCGCTGCAGGCGAGCTGACTGCCGTCATGGGGCCGTCTGGGTGTGGGAAGACAACGTTATTGGACATCCTAGCTGACCGCGTAAGGACTGGATCACTTG
AGGGATCTATTAGTCTGAATGGGCAGCCACGCAAACCCGCAGTCTTTCGGACGGTTGCGCGGTATATAGCGCAAGAAGACTCGTTGTTCGGTTGTTTCAC
GGTGGAAGAGACGCTGAAGATGGCGGCCAATCTCACGATACCACATTCGCCAGAATCGCGCTCGATGATCCAATCCCGTGTGTCTAGAGTCATCCAaGAG
ATGGGGCTCCAGAGTTGTgCAcACACCTACGTTGGTGATATCTTCCGGAAAGGCaTATCTGGtGaCCAGAAACGCCGACTCTCAaTCGCCATTGAGCTAC
TCTCCAATCCgtCCGTCTTGTTACTGGATGAGCCGACGTCGGGACTTGactcctgtgccACGTTCAACTTAaTgAAGTTACTGGTCAATCTCTGTCAACA
AGGCCaTACGATCGTTTGCACGATTCACCAGCCGTCATCGCTTGTGTACGATACCTTTACGAACATTATGATCCTCGCCAAGGGTGAGACAGTGTACTTT
GGGCCACGGATAGCGCTGATCCCAcAcTTTtCCGCGCTcGGAcAcGCTtGCCcAGCGTACTCGATTCCATCCGAGTATtATATTGGACTCGTGAACGCTG
ATTTCGAAGGACACGGAGATATCCCACCGCTCCTAGCAGCGTATTCATCGAGTACTGTCGCTAAAGAAGTGCTTGCAAACATCCAGAACGACCAGAAGTC
GACGGTGAAGCCATTGTCAGTTGCGCTGGTGAAGCCAACATCCGTCTGGCAGCAGTTCTGTGTGATTTTCCATCGCAATTCTGTCAAGAACATCCGCAAT
CCAGGGATCTTGCCGTTCGTCTGATCATGTACTTGATCCTAGCGATCTGTGTGGGTACAATGTACCTCAAAACGAACAAACGCATCTCCGACAACGACAT
TGTTGTGCTTCTTTTCGGTATCCACGCTTTCTTCGTTTCCAACAGTGTGGCTGTCGTTCCCTTTTTCATCCAAGAGCGTGCAATATTCCTTCGTGAACAT
GGCAACTCCTCGCTACGGATCAGTAGCTTTGTCTTGGCCAATTTCTTGGCTGGTATTCCCGGCATCTTCTCTATTTCGCTCACTGCTTCCGTCATAGTGG
TTGCCCTTTCCGGGCTCAAATCATTCGGGTGGTATCTACTTAATATGTTCTTGTCACTTGTCGCCGCTGAATCGCTAATGCACGTCTTGGGTGTGATTGC
CAACGATGGTATCGTTGGTATAGCTCTTGGAGCCAGCCTCTTCGGCATGTTTATGCTGTGCGAAGGGTTCATGGTGCCTCGGGACAGCGTCCCCGGATAC
TGGATCTGGGTGAACTATCTTGGTTTCCACTCGTACGCTTTCCAAGCATTCGTTAAGCAGCAGTTTTACAACGCGTCCACCGCAGGTTCTGTTATTCCTC
TCGCAGTCGCTCGCCTTGGAGTCGAGGACgTCAGTGTACCTGCCACCATGGCCACTCTCGCGGCGTTCACTGTTGGTTTTGAAATTGCATTCGCCGCTAT
TCTCTTTGCTGTTCACACGGGGCgACGGTAAGCAC