Description :
From Genome Similarity Track
Location :
Scaffold_934:282- 1928
Transcript NameFunction/comments
Phypl_g11716reverse transcriptase

Sequence
1646 bases(100 bases per row)
ACAGGAATGGAAGTGCGGACAGTCTAGCCAGCGCAGccctccagcggcagcaaggtgtggtggtggagagcgaggaagagTATCAGGATCTGATCACCTA
GACGAGATCCTAGTCACCCGATCGGAGGATGCAGTGGTACGAGTCCCGCCGGTGACTACCCGATCAGCCGCTCGACCCCGATCTGACCCGCCTGTGCTAA
ACGAGGAGTTTGTCCGAGACCTTCAGATCGAGCGGATCCGGCAGGCGCAGGATGAGGAAAGCTGGATCTATGGCGTGAAGAAGTATCTCGCTGGTGATGT
GACGGATCTCACCCTAGATCAAGCTAGATCACACGGAAAATAGCCGCAGATTACGAAGTAGACGACTACGATCTGTTGTTCTACTGCCCCCCCTAACAAA
CGATCGGAGACCGATCGGGACGGATTGACGAGGCCAGTCGCTCCAGAGACGTTCCACCAAGATATCTTGCATCATTATCACACGAGTATCAAAGGCGGTG
ATCAAGGGATCGGCCGCACTTAGCAGCGGATCCGAGAACAGTTCCATTGGGAGGGTCTGTTTCGAAGCGTGCAGAGATATGTTGGTGAGTGTGTGGATTG
CGAGACGGGCAAGGGCCGGCCTACAATCAGGGGTGAATCGCCCGGGAACCTCCAGGCGCCGTATCCTTTCCAGATCATTGCGATGGATCACATACCGTCT
CTCCCGAAGTCGTATAAGGGCAACACTGAGTTGTTGATCTGGGTAGATCTCTTTACCGGGTACGTGATCGCAAAGGCGAGCGCGTCCCGAACGCTCAGAC
GATCGCCGAATTATACGAAGAATGCGTCTTCCGGAGATTTGGAGCTAGCGAGGCGATCCGACATGATCGGGAGCCAGGGTTCATGTCCGACTTCTTTCGT
GCCTTTAATAAGATCCTCGGTCAACGTCAGCGGGCGACGATGGCTTATCGGCCACAAGCGAACGGAACGGCCGAACGAGtggtgcagacgacgacgcgcg
cgtTAAAAATGTATGTACAGGATCTGGATCAGCGAGATTGGGACGAGTATGCCGAGAGATTGACGTTTGCTATCAACACGGCTCAGGATCGGATCCGCGG
AGATACGCCTTTCTATTTGGTGCATGGATGGGATCCGAGATCGTCGTTGGAAGCAACCGTGCCACTGGGTAGTACGCGGACGCGAGATCGGGACCCTAGG
AGGTGGAGATACCAGATCCAGCGCTATTATATCCAGGCGAGGGCACAGGTCAACGATaagctgcgcaaggcgaTCGCAGATCGGACCGATCTGCACAATG
ATGACGTTGATCCACATCGGATCGATGCCGGAGCACAAGTCTGGCTGTACTTGGATCGGATGAAAGAGGGATACGCGCGTAAGCTGGCACATCTGTGGCA
CGGACCTTTCCGCGTCGCAGAAAAGGTCAATGAGTATTCCATGCGACTCGAGATCGCCGGGACGGAGTACCGACTCTTCCCGATCGTGCATGTGTCTAAG
CTGAAGCCGGTCTGGGAGTTCCCAGATCGACCGCAGATCGAGCTAACTGTACCGGAGGCAGATCGGCTGGATTGTGACGAGATCCTACTGCCAGAGGACA
GTTGGGCATCAGATCTGAACGCGGAGGAGTACGAAGTGGAACGGAT