Description :
From Genome Similarity Track
Location :
Scaffold_176:282- 1678
Sequence
1396 bases(100 bases per row)
CGAGACAACTCCGCTGCGAGTTCCTGGATCCGGAGCTTTTCGCGACGGATTTCAACCTGCAAGACAACCGGACAAGTTAACGGAATGCGTGATGCATGCT
GGATCGCATTTGGCTTGACGAACCCTTTGCTGCTTGGAACGGTCATGAGTTGTGGCTTGAGCCTTGAGTTTGTGGCGAAGTTCGTCCGACTCGATGTCAT
CGATGACACGAACTTGTGGACGAATCGGGACGATGCTGGCTTTCGAGTCGGAGGCTGTATCGTGGATTATCTCACTCGTCAACAATGGTTTGCGTTGCAG
CAGGCCGTTCTTTTGGAGCTCTCGTGGGCTCAATCTGGTCAGAGGAACACACACAAGAACGAAAGTACAACTCGTATTAGCTGGCTACGCAAGGCGTCTA
TAGACAAACATAAACATCAAATAGACGGCCGATTAACAACCATTAGCGGGCTACGTCAACAGAAATGATGCCCACTTCTTGGTCTCGAGGGAAGAGAGCA
AGGTCAACAACCCAACGCCAGCGTAGGGACGCATACATTGAGCTCGAGGCTGGGCAATTATGGACTGGGACAGAGGCACCTCCACTTCGCTTCGTATTCA
TCGTGTCTCGCTATGTTTGGATTGCTCNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN