Description :
From Genome Similarity Track
Location :
Scaffold_24:281963- 283502
Transcript NameFunction/comments
Phypa_INRA-310PPTG_11324hypothetical protein

Sequence
1539 bases(100 bases per row)
TACTGGAACACAAGCGTCACTAACGCCACTAGTACCCAAACTGTTGAACGCGCTAACTGCAGCGCTGTAGAATGTGCTACCTCGTAAGTGATGCAGGACG
AAAGTTACAGTTGGTGAGTTTGCGCTTAGTTGGTGTAGATCATGGGGTCTGAGAGAAATCTCACGGTACAGCTTGCGAACGCGGACACCGAATTGCGTGT
CTTCCGAGTAAAGAGCGACGTTGTAGCCATCAATTGGAAGGCCGTTGCGCTTGGGAGGTGTCCAAGCGAGCATCAGCGTGTGGGCAGAAGGCTCTAAAAG
CTCTGGAGCTGCGGGTGTATTCGGTACATCGCACAAAGTCGCCACACTATCGCTGGGTGGGGATTCAGGGGATGTCAGTAGCTTGTTATCCACCAGATTA
GAAGCAGAGATCGACACTTTAACGGGACGCCCTGGCTCCAATCCGAGGACTGTGTACTTTGTCATAGCAATGGATCGAGTGAGAAGAACAATCGACTGCT
CACTGGTAAAAGGGAATTCCTCGACCTCTTGACTCCACCGCAGCGTGTACTGCAACACCTCACTGCCATTGCAACGTGGTTTTTCCCACTGAACATCGAT
CTGCCGTTTATCGACGCCCGCAATTACAGGTTTTTCAGGCTGATCAGGAGCTGTGCAGTCCATTTTAACGTAGTCACTCACACGTGAAAATTCCCCCAGA
CCACAGCGATTCGATGCGGCAACTACGAACTGGTACACTTCACCAGCCCAGAGTTCGTCCACCGTGTACGAAAGCGTGGGTATAGACGGAGATATTGAAG
TTGGTGTCGATTTCGAGACTGACGCTTTTTTGGAGATTGTGGAAGCTGAGCGAGTTTGTTTAGTGGTCTTCGTGATACCAGTACTGTCCGTCTGCTGGCC
CTTGCTTCGTTTCTCGTTCGGAGCTGGTCCAGTGTTTATCGTTTTCGAGGCTATTGTGGAGCGTTTAACCCCGGCATGAGCAGGTTCGTAAGATACTTCG
AGATCGTCTACGGAAATCGTAATTTCTCGCAGAGGAACAAACGCGCTCTTCTCTGGTCGACACTGAATAGTGTACGACAAAATAGGAGCACCATTCGGGC
ACGGAGGTGTCCAGGAGAGAGTAATACGAGTGGCCTCACGCTTATCGTGATGCACGGGGCGCTCAATTCGAGATGGAATGAATGCGAGGGTCTCTATGGG
CTCAGTTGCAATACTAAACTCACTGGTCCCAATCTAACGAGCAGAAATGTCAGTAAGATGTGAATGGGTTGGGTACATTCTACTTGAGTCTACCTGGTTC
ACTGCTGCCACTTCAAGCGTATACTTGACCCCTGGTTGGAGTTTATCGACAGTTTTGGACAAATACTTCGCTGGTACTTCCTTATCTGCAATGACCACGA
TATCTCGATTGTCACTATTAAATGAGCTCACCTGTTTCGTTCGTACTATATAGTGGAGAATTTTAGCACCGTTTGCTAGTGGTTCAGTCCAAGAAATGCT
GATCGAAAAGCGATCCACCGAAATCACGACGGGTAGTTC