Description :
From Genome Similarity Track
Location :
contig_83:28195- 32174
Transcript NameFunction/comments
g12249.t1hypothetical protein

Sequence
3979 bases(100 bases per row)
ACAGCGACACACTTGACTGCTTCTTGCTTCCCCAGCTCACAGGCGCACTCATCAGCATGAACGTGTAGCCTGAAGTGGACTTGCGGTCGGCGAGGTCGCC
GGCCCAGTCCGCGTCCGAGTAGCCACGAAAGTCGATGTTGTCGCTGATGGAAGGTATGGATCTTGACACCGAAGCTTGACGGAGCGGAGGGAGGGCAGCA
CTCTGGGCGAGACCGGAGCGGAGACTAGAAACCACTTGAGGGGTAGAACGAAGATTCGAAAGTGATTGATTGAGGTCTTTAGCTCGCTAGCCTTCTCGCT
ACTCTAGACCTACTGGATACACACTACTTGATTCTTTACTGGATACTGAGTTACTTCAGCCAATGAGAGAGCGCCACGTCGAAGCCCATCTTGTACCTAC
AATCTTGTACCCACAGGTGGCGTAATCGACAGTGGCGTAATCGTCGGTGGCGTAATCGGCGTGGGTTCGGATTGGACCGGTTCGGGTTAACCGGTTCACG
GTCAACAACCGATACCAAACCGGTAACCCTCCATACCCTCAATACGCCCCTCAAGCGAAGTCCCATGAATGCCGAGAGCCGCCGTCAGCTCCGTGTGGCG
TGGTCCCGCAAGCGCCTTGGTCATGATGTCCGCCAGCATCACAGAAGTCTCGCAATACTCGAGCTTCACTTCACCGCGTTTCACTTCGTCGCGGATGTGG
TGGTACTTGATGTCGATGTGCTTGGCGCGGCCGTGGTTCACCGGGTTCTTGGTCATCTTGATGCACGACTGGTTGTCTTCGCGGATCATGAGCTCGGGTC
CCGTGTCGTTGGCAGCCGCCAGAATCTCGCAGCAGCAGAGCGATGGATCCACTTGCCCTCTTGGATAGCCAGACTGAGCGCGATGTACTCCGCCTCGCTC
GTGGACAGCGACACACTTGACTGCTTCTTGCTTCCCCAGCTCACAGGCGCACTCATCAGCATGAACGTGTAGCCTGAGTGACTTGCGGTCCGCGAGGTCG
CCGGCCCAATCCGCGTCCGAGTAGCCACGAAAGTCGATGTTGTCGCCGGCTTGAAGCAGATGCCATGCGTCTTGGTGCCTTGCAGGTAGCGAAAGATGCG
CTTGACCGCAACCCAGTGTTCTCTTGGGGTTCTCCATGAAGCGCGACACATAGCCAACGGCGTACGCGATGTCCGGGCGCGTGGCGGTCATCAGGTGCAT
CAGCGCACCAACAGCTTCGCGAAACGGAGCGTTCACCTTGGTCGCCGCGTCGCTTGGAACCAGTCGAGTGCTCATGTCCACGGACTCACCACAGCCTTGC
ACTCGTCCATGGCGAAGCGTTTCAGGATGTCGTCCACGTAGCGACGCTGGCACATGGTCACCGCTGCCGTCCGGCCGTCCACCAGCTCGATCCCAAGAAC
AACGCGCACTTGCCGCTGTCGGTCATCTCGAAGCGCGTCTTCAGGTCCGTCTTCGTGCGTGCGATCAGCTCGGGCGAACTCCCGGTAATCAGCACGTCGT
CCACGTACACCAGCACGAGCACGCAGTGACCGTTCACCACCTTGATGTAAGAGGCACGGATCGAAGGCCGACACTTGGAAGCCGATAGAGCACATGAACT
CGTCGAAGGTCTCGTTCCACACGCGCGAAGTTTGCTTGAGACCGTAGATGGCCTTCACCAGTTCCAGGCAGTCGAAGTCACCATCCAGTTCGACGCCTTC
GGGAACCACGCAGAACACCACCTCCTTCATGACCCCGTACAGGAACGCTGTCACGACGTCGAGTTGGTCGAGAGGCCAGCCGAAGTACTTGGCGATCGCG
ATGATCATGCGCAGCGTCAAGTACTTGACCACGGGCGAGAACGTCTCCGTGTAGTCGATGCCGTACTTCTGCTTGAAGCCCTTGGCCACGAGGCGCGCCT
TGTACTTCTCGATCGAGCCGTCCGCTTTGCGCTTGATCTTGAACACCCACTTGGTGCCGATGGCGCGCTGGCCGCTGGGCAACTTGGCAGCTCGAAACAC
ACCACGCAGTCGCATCGACTTGAGCTCCGCGCGGATCGCCTTGCGCCAGTGCACTTGATCCGGACCGTTCACAGCCTCTTGGAACGTCGTCGGCTCCGAT
AGATCGGCTGCTGCTTCACAGCGTTGGCACTGGCACGCCAAAACACTGGAGGCGTCGATCGTCGTCTTCATCTTGGTCCCCAGACTTTTCTTCTTCGTCG
GGTTCAGCTCGGCGCGACGAGGATACGTCCGGCGCACTTGCTTCTTCTAAGCCAGCCCGGTGGCGAACGAGGCGCGATCTTCTGGCAGTGTCGTCGTCGC
CACTCGGTCGGCTCTTGCGCTTCCCGCCTGCTTGAAGCTCGTTTGGCGCGGTCCATCGTTGCCGTCCAGGTCGAGCGCGTCCAGGTCCAGCGCAGCATCA
TCGACGTCTTCATCCGAAGTATGCGCCGAAAGTCCAAAGGCCGACTCATCGAAGTTGACATCGCGACTGACAACCACCTGCCCCGCCTCGATGTCATAAA
GTCGATACGCCTTGGACACTTCTTCGTAGCCGAGGAACAACCCGGCGCGAGCCTTGGGGTCCCACTTGCGCCGCTTTTCCTTCGGCGTCAGGATGTACGT
CTGGCATCCGAACACACGCATGTGCTTCACACTTGGCTTGGACTTGTACACGATCTCGAATGGAGTCTTGTGCTCCACCTTGGGTGACGGCAGGCGGTTC
TTCACGTAGATGGCCGTCATGGCCGCCTCAGCCCAGAAACACTTGTCCAACTTGGCGTGATGCAGCATGCTGCGGCCGATCGTGACGATGGTCCGGATGG
CGCGTTCTGCCGTGCCGTTGGTCTGGTGCGCGTACGGAACCGTGGTTTGCTGCTCGATGCCTTCGACTTCGTAGAAGGCCTTGAGCGAGTTGGTCGCGAA
CTCACGAGCTCCGTCGTGCCGCACAAACTTGACCTTCTTGCCGAACTGCGTCTGCACCTTCGTGACGTACGTCTTGATGCAGTCTTCGCTCTCCGACTTG
GCACGCAGGCAGAACCCCTTCATGCATCCGCTGGCTTCGTCCACGATCAGCAGCAGATACTTGCTGCCACCCAGTGACTCTTCTTCCATGGGGCCGCAGA
TGTCGAAGTGGAGCAGCTCGAACGTGTCGTAGCGACGCTTGTCACGGTTGCTTGGGAACGGCTTCTGGACCATTTTCCCTTGCTGGCAGCCGCGACACAC
GCTTGGTCCACTCGACTTGGAAGGTGCCTTCGCGTCCTTGATCATGTCGTTGTCGACCATCTTGCGAAGCACCTCCACCGGAGCGTGACCCATACGCGCG
TGCAGGTCGACCGTCTTCCCACTGGTCGCCGCATTCGCCGATCGCTGAGGCGTCTGGAGCCAGTAGAGGCCATCCACGAGGTTCGCCGCCGCCACCACTT
GCTTGGAGGCCTTGTGCGCAACGCGCATCTGGGTGCCGTCGAACACGACTTGGAACAGACCACTCTTGTTGATCTGTGGCACGGAGAGCAGATTCTTGCT
CATGCTCGGCACGTACAGCGCGTTCTTGATCTCGATGTCGCGCTCGTCGCCGTTGGGCAGAACCACTCGTTCCACGATGGTCCCCACACCCATGATGGCC
GCCTTGTTGCCGTCGGCCACCGAAAGTTCGCCCTCGTTTCGCTCAATCAAATGGGCGAACTTGGCCTTGTCGTTGCAGATGTGGTGCGTTGCGCCGCTGT
CGACCGCCCACATGCCGAGCATATCCTTGCCCGTCGAAATGCCACACTCCAGTGAGACCGCGAACGCCACTCGATCATAGCCGTAGCCGTAGTCGTAGCT
GGCGTCGTCGTTCCTCCACTGGGCATTGTTGGCCCCGCGTCCACGGCCATTGCCATTGCCGCCGCGTCTTGGGCCCCGATTCTCGTCCTTCTGCTTGGTC
CAGCACTTGTCGATGGTGCCCCAATTTCCCGCAGTACGTGCACTGGCGAGACTCTCGGTCGGTGTTGAACGCCTTGGCC