Description :
From Genome Similarity Track
Location :
Scaffold_27:28195- 31267
Transcript NameFunction/comments
Phyag_g747conserved hypothetical protein
Phyag_g748P-type ATPase (P-ATPase) Superfamily

Sequence
3072 bases(100 bases per row)
GCTCTTTGGGGCTGGAAAATGTGTCAGCGGCGCGGATGTGTTCTCAGTGATCCAGGACTGGTTTCCCAGCTCCATCGTGGACGTTGTGAGCACCTACTTC
TCCAATGCGTGTCTGCATGTGCCTGTCAAGTACGCCGACGGCTGCAGTTTTTCGCGTCCAGCGTCTCTCGTGGATTGGGACTATGAACCAGCACATGCGA
GCCAAGCGGGCTCGGAAGAGGCCGGGGATGGAACGTCCGCTATCAACTCGATTAACACGATGCCGCCGAACGTGACAACGACCTCAAGCGGAGCTATCGC
CAAGTCttcactcgctgctgctgctctagtGCTCGGTGTTTTGATGTCATTGTGGTAGCTAGCCAACTTCGTTGTTTATAGAGGAGAAATCTGTCTTTCG
TTAAGACCTGCTAGTTCCTTGGATATGTACATGCACTGTGTCGATAGCACCTGGGCGTTCGCTGTTCTAGTCGACGCTTGATGACCTCAGCCTCGCAGCC
TAACACGCAAAAACAAAAGCTAAAACTTTAAAGCTCAAACGACACCAAGTGGCCGACAATAGCATCTTCCAGGCTTGATCTTGACGCCGACGAGCTCGAT
ATGTAGAGTACGCATGTCGGTGATGATAGTGTAACTAAAccttccagctgcagcaactaGACGAACAGCCCCGTCGAGGAAGAGCCCTTCGTGGAGTCCA
CGACAGCCGCTGAGCGCGACGACTCGTAGTCGGACGATCGCGAGTCTTCTCGAGACCTCCTGCCACGGTGTTCTGCATCGTGCATGGCTGAAGCCGATTG
GCGTACGTCGTGTGTTGACATGTACGACTCGGCCAGAGACGTCTGAGGGTCGTAACTGAACGCGAATCCGCTGCCAGATCCCCTTGTCTTGGCAGCGTAT
TGAGCCTGTGCctgctgtggttgctgcagaaACAAGAGCAAAGCAAAGAGCGTCAGATAACACATTTAAGTGGGCAACACACGAGCCTGAAACAAACACA
ACTTACCACGTTGTAGGCGCGGTTGCTTGGAGATGATGAGTTGATGTACgcggtgtcgtcgtcgtgagGCATACCGTTAACCACGGGGATGCCGCCAGCT
TCGATGTCGATGTGGGACATCGTGCGATGTTGCGGCTTGCCCTTGTGCAGAACATACTGCTCCTGGACAATCTGCCACGGTAGCGGGTAGAATCGGCGGC
AAATTGCCGTCCACGTGAAATGGCGGAGCAGTGAAACAACCAAGCAGATTGGAATCACCATCCAATACGTCTCTTGTCCCAACGTGTTCTGGAAGCTGCC
GTACTCCGTGGAGAACATCGAAATCCAGTAACTGGAGATGATCGGGGTGAGCGGCAGGTAGGCAATGACGCCCACAAACCACAAGATAGCACCGTAAGAG
CTCCAGGACATCTGCAGCATAACCAGCTTGATATTGGCTATCAAAACCACCATCGTGAACGCGAGCAGTCCGTACTGCACCATCGGCGCACTGCCCGCAT
TGGAGAGACTCTCGTTGAACGCGTAGACCACAAACACGAAGATTACAGCTGACTCGTACACTGCACTGCAAATCCACTTGAAGAAAGTGTAGttgttgaa
gagctccatgCGCGGGCCAACCAGGTACAGCTCCGGAAAGTGCCTACTGACCTCAAAAGGCACGTCGTAGTCGAAGACTCCCAGAACAATGATAGGAAGC
GATGTGTAGCAGATGTTGTACAGCTGGAATCCCAATTCACCGTAGAACTTTTGACCGGACGATCCCGTGCAGAACATGTAAAAGTActgcgccagcacca
tcacaATATTCTTGTAGAACATGTAACCCGCAAGAATAGACATGCGCTTGTAATTCAAACGACCGTGGTGCAACAGAAGCTTCTCCAGGAAGTAAAACTG
GCCAATTGCGTAGTCACTCGAGTTCACAGCTTGCATACCCTCTTGGCCCGAGATACCCACGCCAACATGCGCACGCTGAATCATAGCAACATCATTGGCA
CCATCACCGATCGCCAGTGTTCGCACCTTCTTGTTAGTAGTGCGTACCAGAGTCACTACCTCAGCCTTCTGGCTGGGAGATACACGACAGCACACCACAG
CCTCGCAGGCCATGGTCAGCGACAATAACTCCTTTTGGCACCGTTCGTCTGCCAGTGTCAACTCCAAACACTCGCCGTCAATAACCACAGCGTGGCGACC
ACTGCCTCGTTGGACCTGGGCGTTCGCTTCTGTAAGTTTTGCAAAAATTGCGTCCTTGGTTGGGTATAAGTCGCAATTGAAGATAAACTGCTCCATGTCG
TTATCCATGAGTTGGCACGCATACGAGATGTTAATGGCAGTTTCCTGCTTGTCACCAGTAAGCATCCAAACCCGCATGCCCGCACGCATGAGATTGGCGA
TGCAACTAGGCACGTTGTTCTGAAGCTTGTCCTCAATAGCTGTTGcacccagcagctcgagatcACGCTCGATTTCTGTCATCAGCTTGTCGATTTCATT
GGGCTGGTCGTTCTTACGCTTGTCAATTTCTTCGAGGGACGAGTTCGCCTCCTTAAAGCGCGCACTCCAGTTCAGGTACTCCTTCTCATCCACGCGACGC
TGAGCAATCGTAAGAGTACGGAGACCATCATCGCCAAACGTCTCCAAATGACgcatcgtctccttcatcatTTCGGGGTCGCTCttgtccttggccagca
tAGGATAAATCACGTTGTCAGCACCCTTCGTGAGCACCCAGTACTCACCATTGGGGTACTGCACCACAACCGACATGCGCTTACGGGCACTGGTAAACTC
CAAAACGTCCAAAATCTTGAACTCCAGAAGAGCATTCGAGCCAGTGACGTCGTTTGCGTAGCGGCGGATCAGCTCTGGGCGCTTCACACGCACACGAGCA
ACGCCCAGACCTCGGGATTCAAAACTGAAGCCGAAGAACTTTGCGCCTGATACCAGCGCCTGCTCATCGGGAGATGAGGCCGAGAAGCGCACCTCGGAAC
TGCCTTCCACCGCCTCCGGAATGACAGTTTGACACAGACTCAAGTGCAAGAAAAACTCGGCTTCACGGTTCG