Description :
From Genome Similarity Track
Location :
Scaffold_3:28181- 29934
Transcript NameFunction/comments
Physo_155337MYO2p

Sequence
1753 bases(100 bases per row)
ACATGCACGAGGCGCCGCTGCTCAACGTGCTGCGCCAGCGCTTCGAGCGCGACGAGATTTATACCTTCACGGCGGATATCCTGCTGTCCATCAACCCGTA
CAAGTCCATCCCGCTGCTCTACGACGTCGTGGGCTTTATGAAGAGCCGCGAAGAAGCTGCCACCGCCACGGGGGACGGTTCTACCAGCGACAGCAGCGCA
CCACCTCACTTGTTCTCCATCGCTGAGAAGGCCTACACAGGCATGAAGGGCGTCGTTCCTGGGTCTGGAACCCCGCAGTCGATTGTCATCAGTGGAGAGA
GCGGCGCCGGTAAGACCGAAGCCTCCAAGTACATCATGAAGTACCTCGCCACTGCGAGCAAACACGCCGCCAGCTCTAGTACAGTCGCTGCAGGCGTCCA
CGAACAGATCGAGGAGTGCGTGGTGCTCTCCAACTTGATCCTCGAGTCGTTCGGCAACGCCAAGACGTCGCGCAACGACAACTCGAGCCGCTTCGGCAAG
TACATCCAGATCCACTACAGCAGCGAAGGGCGCATGGCGGGCGTGTCCATCCGCCACTTTTTGCTGGAGAAGACGCGGCTCGTGCGACCGGAAGTGAACG
AGCGCAACTACCACATCTTCTACCAGTTGCTGGCGGGTCTCGACACTCTGACAACCTCGTCGTCGGACCCTTCGGACTCGGATCGACCCTTGTTGCTGCA
GAATGACGTGTGGAACTACACGTATCTGACGCGTGGAGACTGCGTCGAGGTGGACGGAGTGGACGATGCCACCGAGTTCGAGCAGCTTCGTCGGTGTCTC
GAGCAGCTCGGAATGGACAACGCCAGCTTCCAACGCCCTATGTTTGAAGTGCTTGCAGCCATCTTGCACCTCGGTAACGTGCAGTTTGAGAGCCCCACAA
CGCAGGACGACACAAATGGAGACGATAGTCGCGAGAACGACCCAACACATGTCGTGTTCCCAGAGAGCGACGCTGGAGTGAACTTGGAGCACGTTGCGAT
GCTGTTGGGTGTCGATGCCGCCGAGTTCGCGAACAAAATGGTGACGCAGACCACCGTAACTGGTCGTGGCAGTATCCTCGAGATCAAGCTCACACCGGAA
CAGGCCAAGAATGCCATGGACGCCTTCTGCAAGTACCTGTACGGCGAGCTCTTCCACCACGTGATCACACGCATCAACGCCTGCGCCAAGCAGCAGACGT
CTCTGATCCCCACAACGGACAAAAAGACGCCAAAGTCTCGTGTCCAAGGCGGTGCAACAGCGCCCACGGTAGCTCCATTCATCGGCATCCTGGACATTTT
TGGCTTCGAGGTGATGAAGCGAAACAGCTTGGAGCAGTTGTGCATCAACTTCACGAACGAGACTCTGCAGCAGCAGTTCAACAAGCACGTATTCGTGCTG
GAGCAGGAGCGATACGCCCGAGAAGGCATCGCGGTGTCCCCCGTGGAATTCCAGGACAATCAGCGCTGCCTGGACCTCATTCAGAAGCCTCCTCTCGGAC
TTCTGCCTCTGCTCGAGGAGCAAATGCTGCTCAAGCGCAAGACCACGGACAAGCAGCTCCTCACGATCTACCACGGGAACCACCTCGAAAAGCACCCGAG
CTACGCGAAGCCACGCTTCGAGTGTGACGAGTTCATCATCCGCCACTACGCGGGCGATGTCGTCTACGATATCCACGACTTCATCGCTAAGAACACCGAC
AACCTGCACGACGACCTGCTCGACTTACTGCGTCGCAGTTCCCAGCCGCTACT