Description :
From Genome Similarity Track
Location :
Scaffold_1636:2818- 6244
Transcript NameFunction/comments
Phyta_totarag13395conserved hypothetical protein
Phyta_totarag13396hypothetical protein

Sequence
3426 bases(100 bases per row)
GTGGGACAAGAAAGGTGCCGCTTGTCAACGGAGCCCTGCCCTGCAGAACATCGGACACCATGAATTCATGCCATCTTACAGAGCATCACGGCCATCATTG
CTCTGGAAATACCGTTGTCTGCCTGAAAATACTTCTCGTCGGTGTTCTCGTTGGTTGGAGTTATTTTTAATGCTCTGACTGCGAGCACGAAACCTCACCA
TCGGCAATTATGGGTAATTCTGGCAAGTACTCTTCATTCTCGCTTGGGAGCTCCAGACTGCAGATTGTGTTGCCTGCTGAAAGTAGCCAAACACTCGCTT
TACTCGACCTCAACACTACAATTGGCACCATGCTTAGAAGGTGAGTTTCACCTTGTCGATACAAACACAGGTCGCACACAGTGAACTGATAAATTGACGC
ACAACGGCAGTCCAGAACGCCACGCGCATGATGAATCGTGCCCAGATCAAGTAACCAACCAGAGCCAGGAAGTTCGTCCGACATCATTGCCAGCACCGCT
TTCTGGTGCCGAGGTATGTGAACTTACCACAGCTACCAACCGATTTGACCTCACCACAAATGTATTTTCAGGCCACCCAGGCGTTGTTGAAAGCTAAAAT
TCGCGAAATCCAGTCAAGCCCAGTATTGACGCCGAAGCAAAAGGCTGAGTCGGTGCAGAATCTCATGATGAAAGACTGGAATGATGCCAAGTCTAAggca
ggagcagcaaaaacGGAATGCGATACCGAAGTTGAACGCAAACGAGCATCCTATCACGTAGGTCGGCAAGTTTTTCGTGTTTCGGACAGATTATTTTACT
AACATTGCGGGATGATTCTTACAGGATGAAGTTAAGACTATCTTAGGCTGCAGTCACTACCAGTGCGTGGCCTCAAGGCAGTTTATCGTGAGCTATCAGC
AGACTTGCTAATTTACTGTTCGTTTCTCAGGCGGAAATGCAAACTACTGGGGAAATGCTGCGGAAAATGGTATTCATGCCGCTTCTGCCACGGTAAGTCA
TGCCCTGATCATCGTCAGACATAGAGAGTCGCTAAAACCAGCTTCTGATGTTGCGCGTTGCGTGCAGATGACAATGAGGACCACGCCTTTGATCGCTACG
CCACCGAGTCAGTGTCGTGCATGAAGTGCGATACAGTTCAGGTACGGTTAGTCGAGTGAAACTTTTCAAACGCAAAACTGATATCGGTGTCCTCACTTCT
GAATCTCAGCCGATCGGGAAAACTTGTGTGAACGAGGACTGCAAAAGCGAATTTGGTCGCTATTACTGCGAGGTGTGCAGGTTCATCGATGACGACAAAG
AGAAGGACATCTACCATTGCGACAAGTGCAAGATCTGCCGTATCGGCAAAGGTCTGGACATCGACTACTTCCACTGTGATCGCTGCAACGCTTGCATGAG
CATTagcttgaagaagcacaagtgCGTGGAGCGGTCGCTCGAGTCCGACTGCCCGATTTGCCACACATACATGTTCACTTCGACGACGCCAGTCATGTTC
CTTCCCTGCGGGCACTGCATGCATGTGTCCTGCTACGAGGAGTACACACTGGTACGTTGAGCACTGCTGATTCGTATTGCAGCGTCGTCTTTGTAGGCTA
ACATTTGATCGTATTGATGTTGCAGACAAACTACATCTGCCCGCTGTGTTCGAAATCTCTTGGAGACATGGAGCTGTACTTCGCCAGCATTGACGAGCTC
TTAGAGCGGGAATGTATGCCCACCGAGTACGAGGACTACAAGTCGCTGATCTACTGTAGCGATTGCGAGCGAAAGTCTACAACCAAGTTCCACTTCGTTT
ATCACAAGGTGCGGTTACTGTCACAGCCTTGCGAAGTTGTTGTGGCACTGTAAATTAACAATCTTGTGCTGTGATTCTTTGCTTTGTGAAGTGCCAATAC
GAAGACTGCATGTCATACAACACCAAGCTGCTCCGGCAGTTCAAAGACTGTGAGGGGCAGGTTGCTTGCGGCCCCGTCAGCCAACTCTAGCAGAGCCAAG
AGGTAACACAGCAAAGAAAACTTGGATAGTCGCAACACGCGAGTCATATAAAGCCAACTAgaagctacatgtagcaacttgttgctgcgagAGCAGATCT
ATTGGTTGGTATTGCAGTATGTACGACCCAGTTCTTGAGGAGTTTGACGAATGAAgtagtcgtcgtcctctACACACATAGGGTACTTGGGATTCACTCT
AGCGCCCGTGGGGGTGACACGACATGCCTTGGCTCCTCATTACAATGAAACACTTTTCAGCGCCCCAAGCAAAGAAGACCCTTGCATGCGGGCCCTTACA
AATTTCCACAGCGCAACATCGAATTAATGCGTTCATACACAAAAAGAGACGTAACTGCATTTCATCCCTGCTCAATAAATTTGCAACTGGTACGCCTCTT
TGAATGGAGGAGAGGCTTCTCTCCTCCATTCAAAGTATCAACTGTTCATTGGATAGATTCCACGTCAAAAACGAACCAATGACCGGTTGATATTTTGAAC
TTATTCACCAATAGGGGATGCGTATCTCGCTTCAACgtcgaagatggctacatgcGCCTAGACAGCATTTGACGTGGAGCGCTTGTTCTTGTAGCACCAC
AGCACATACTGGCCAATTTTAGAGTGCTGAAGCTTCTCAAGTCGCTCGCGGAAGACCGGGTGGTTGATTATATCCAGCGAGATGTATGGGGCGATGAATT
CGTGCTCGGGGGgcaggacgagcagcgcaACATGGGAACAGAACACGATGTCTGCAGCTGAGAAGGTGTCGCCAGCAAGAAACCGAGTGCCAATAGGACC
GCCTCCAAGttccttctcggcctcctTGAGAATACTTTCGATACGAGGCCACGACCGCTCGGCGGACTTCTCGTTGATGTTCATCGCACGCAGCAAGAGC
AGTCTAATCGCAGGATACAACATCTGCGCCAACGAACGCTGCACCAAACCGTCGATCGGGTCCGTCATGAGTTTCTTGGACGCCCTCTTGTCCTCAAACC
ACAGAAAGTAGGCTGCGTTCAAACGATTTAATGTAGTCAACGACACTCATCGAGTTTACAGAGTTTTATGGCCAACACTTGACATCTTACCACATCGACG
CGCGTGAGGTCCGAGTTTAGAGTCGAAGAACTTCTCGAGATCCTTGGCTTTCTCACTTGGGTCCGGGTGTTTTCTTGGCACAGAAGGCCACAATTTCCGA
GCTGTCGGTCAAAGTCACCTTCGGGGTTCCTGGTAGCGTTAGCAGCGGCACGGCGCGACCGCCCTTGGGGATCGTTGACGAATATGCGAGGAATGGAGCC
CACTTTTCTTTAACGAACGGTATGTTGACAACACGCAGTGTCCATCGAGCTTTCTCAGCATAGTTTGATGCTGGAATTGTTACGAGCGTACCCTTTGGTT
CATCACTTGCGAACGACGAAAGGGAG