Description :
From Genome Similarity Track
Location :
Scaffold_61:281741- 283793
Transcript NameFunction/comments
Physo_138239hypothetical protein

Sequence
2052 bases(100 bases per row)
ACGGCCACGCCAACGTCGACTACGGCCACGCCCACGGCCACTACAGCCACGCCCGAGGCGACGACGGAGACGCCGACGTCCACCACTGCCACGCCCGAAG
CGACGACTGCCACGCCGACGTCGACGACTGCGACCCCCACTGCGACGTCTGCGGCGTCTTCCACGTCGGCGGACACGACGGCCGCTTCCTCGTCCACGTC
GGCCGTGACGTCCACGCCGTCAGCTACTGACATTGCCAAGATTTCGTCCAGCTCCGGCTCGTCATCTAGTGCCAGCGCCGACACGTCGTCCGGCTCGAGC
ATGAGCACGGGCGCCGTGATCGGCATCGTCGTGGGCATCGTGGCTGCCGTGGCCATCGTCGCCGCCATCATCATGTGCGCCATCCGCAAGCGCCGCGAGG
CGGACGACGACCCGCTGTCCCCCTTCGAGCTGTCCATGGACAAGGGCTACAACCCCACGCCGGGCGGTTTCGCGGCCCAGAACTCGTACAACCCGCGCGT
GCTGAGCCATGGATCTGGAGTGGCCGGCGTCCAGGACACGCGGACCCCACCGGCCGACACCGTGGCGGCTGGAGTGGCCTACTCGCAGTTCTACGACAAT
GCCGCCACGTCGCCGGGCTCGATGAACCGACTGGAGAGCAACGTGGACTCGGTGCAGACGGACCCGGGCAACAACGGCCCCGCAAACGGCACCAATCTGT
GGCTGAGCGCAATGGAGCCCAAGGACAACGAGTCCTACCTGAGCGCGCAGGAGTCTCCGCGCTCGTCGCGCAACAGCAGCCGCAACAGCTACGACAACTC
GTTCAACCAGAACATGGACGTGGACCAGAGCAGCCAGATCAGCGGAAACAGCAACAAGGAGAGCGACGACTTCCCGGACCACCACGAGGACAACGACTCG
GCGCGGGGCTCGTACGAGCTCTAACGAAGCCCATCAAAACTTTTGAACGTGACTGAGTAAGCGATGCTACAGCGAGCGGCGACACACCGGGACCAAGGCG
AGCGCAGTCTTCTTCCGTGCCGCCGACCTGTAGAGTCTGGAAGTGGTTGCAATGCGTACATGGTTGGCTGGTTGGTCGGTTTGGGCTGCTGCTGGTCTGT
TCCAGAAGGGAATGGAGCATTTCGGCTCGGCACAGCAGAGTGAATCAGGCAGGACGGACGTTGAGTTTTTGAAGACCAGATCCGATGTAGAAAGAACTGA
CGAAGGTGGCAGCGGCGAGAGAAGAGAAGAAGAAGAAGAACGAGATGAAGATGCCGCCAACGGATCCAATATTCTGTCGTCCGCAATGAGACGGTAGTAA
GCAAGAAAGCACGGAAGGTTTCTCTAATTTATACAAAAATGAACTGCGTTAGGCAAGTGCTGCACTTACCGACCTCCCTCCAGCTCTCTGTGCTGTCCGT
TTGCAATTCCAGCAGCTCCTCCCAGTGCCAAACATGTTGATGTCCAGGAGATGGCTTGTTCACGTACACATCGAAGCCGTAGTTGGCGTCGGGAATACGA
TCTCGAAACGCTGGCCGTGTCTTCTTCTTCATCGCCGTCGCGGAGCGGCAATATGTGCAGGCACAAACATGGGGGTAATTCGCTCACATAGGACAACTAC
GTATTCGATACTTCGCAATACATACTACACGCGTTCGGCGTCAAAACTTGCATGTTACGCTGAGCTCAACAATTGATACTAACATGTACCACCGGTAGTA
TCCATTTCCTCTCGCATACTCCACCTCTCCCATGAACGTAGAGCTTGACGTGACAACACGATGCTGTTTTTACCCTACACGCGTTCCATCAACCAGGTGG
ATCATACTCGACACCTACGGCTTTGATATCCACCAGACAGGGTTCAAACGGCAAAACTGTACTTGGAGAGCTGGATCGTGTCACTCGTTCTGGTGGACCA
GCGACCGCCAAAATGTTTTCTCTGAAGTCTGTATCATCCGTCGGGAAGTTAAACCTCGTCAGATTACACTCTGGAACAACGAAGCACATCTCAATTATTT
TAAACGGCATCAGCTTCTTCTCCGCTGCGAGCTTGTTCAGTACTTCCACAAA