Description :
From Genome Similarity Track
Location :
Scaffold_15:281610- 283414
Transcript NameFunction/comments
Phypa_INRA-310PPTG_08075plasma-membrane proton-efflux P-type ATPase

Sequence
1804 bases(100 bases per row)
GGGTGGAAGATGGGCAGATCGTCCTGCAGCTCCATCTTGTTGCGGGTGAGTGTACCAGTCTTGTCCGAACACAACATGTTCATACCCGAGAGGGTCTCAA
TGGACTGCAGCTGCGTAACGATGACCTTCTCCTCTGCGAGCTTACGGGAGCCAAGAGCCATAGTGGACGTGCATACAACTTGCATGGCAATGGGGATGGA
AGCCACCAGCAGCACGACGCAGAAGGCAATAGCCTCCAGGAAGTCCTCGCCATTGTAGATGAGGTAACCGAGACAGAAGCCCACAAGCACGAACGAAATG
GCCATGAGGAACATGGTAATGCGGATCAGAATCTTCTGGAAGTGGCTCACTTCGTCCACGGACGAGATGAGACTCGCCGTCTTGCCGAAGAACGTTTGGC
CGCCTGTAGCGGACACCACAGCCTCCACCTCGCCACGTACGACGGTGGAGCCCATCTTAGCGTTGTCACCAGTGGCCATCGTCACGGGGAACGACTCGCC
GGTCAGCGCAGCCTGGTCGATCTGCACGGGGTTGCCCTCGCACAGATCGCAGTCAGCGGGCACAGCCGAACCGGCCGACAGTGTGATGCGGTCGCCCGGC
ACGAGCAGAGCAGCGTTAATAGTTTGGTGCACGCCATCGCGGATGACCTGAGCCTCAGGCTTGAGACTGGCCTTGAGTGCAGCGACGGCGTTGCCGGCCT
TGAGCTCCTCGTACCAGCCCACGATGCCGTTGAGCAGCTGCAGGAAGAGCAGCACGAAGAAATCAGGCAGATCTTTGGTGATGGCCTCGACGAGGATGGC
GAGCCAGATCATGATAGGCATGGGGCCCCAGAACTGCTCGGCCAGCTTGACCCACGGGCTCTTTTCCTTGGTTTCGAGCTCATTAGGGCCGAAGATCTTG
AGTCGACGAGAGGCCTCCACGGTGCTGAGACCAGCCTCGCCCGTATCCAGCAGCGAGCGCTTGTCCACGCCCATATAGAAGCGGTCGTCGTTGCTCACAC
CGCTGTACGAGTGCTCGTCGCCGTTGGCGAGCAACGGACTGTGCTCCGACATTGTCACTTTGGTCTTCTTCAACTGTGGCGATGTGGGGGAAAACGAGAA
GTGAGCGATCCGATGGTGTCCGGCGGCAGAGCTCTCTCTCCCTATTTATCCAGGACTCAAAAGATTCGTTTTCGGAGTGGACCAATCAGAAGCGCGGAAT
GGTGGACGCGCCCCATCTCCAAAATCCGTTTTTTGTGCTTTTGACAACAATTGTGGCGACCAAAAACTCCGATCATGCTTGCGGTGGGGTCAGTGAGAAA
CCCAGCTGAAAGCGCAAGCGAAGTTATACAGTCGTGCTAGGGTGTATGCACCTTGTACAAACTAACTGTAACTCTGCCGTGTGTGCGGCACGAGACGCCG
GGCCTGCAGCTGATGAAAATAATTTCGTAGCGGATACTGCGCCCAGATGGCAAAGTTTGGAATTTGATCCCCACACACTGTGATTTTTGCCGTGTCAGGT
ATCGCAGATGTGAGACCAAGTGGGGGCGCACGGAATGGGCAAAGCTGAAGATTTATGGCGGATCCACCGCCACAACACAAACAAGCTCGCTCGCTTTTCC
CCGTGGACAGCCTCGAGATCGCTCCACTTGAAGTCAGATGGTTCACGAAGTATCCACACAAATCGTCTGCAGTGTCGAGCTCAGTCCAGTTCGGAAGCAA
ATTCTTCGCCGGTCTGCTTGAGACGGTGTCGATATCGCTCGCCGCAGTCTGCGCTGGCGTTCTCACGCCGTACATGTTCAAAGTCTCAAAGTTTTCCTGC
TGAG