Description :
From Genome Similarity Track
Location :
Scaffold_82:28153- 32149
Transcript NameFunction/comments
Phyag_g1742hypothetical protein
Phyag_g1743hypothetical protein PHYSODRAFT_532554
Phyag_g1744notchless family protein

Sequence
3996 bases(100 bases per row)
AGGGAATCGCCAACAGAAGAAACCTAAACGAGCGCCAAACAACCAGCAGAACGCGGGTATTGGGTTGTTAGATCGCTTCATACTCCATGGCACCTGGTCG
CAAGACAAAACGCAGACAGTTGCTAAAGAGGAGTATGCTGTTGTTACCGAGGCGTCCCAGAATGCCGCCAGTTTGACTCCAAGAAACAGGAGTCAACTTG
AAGGCTCGGCATGCCAGACATTGCAGCCACAAACTGACGACACTGAGGCATGCGAGGTCGGTGCGACGCCTTCTGTTCAGGTTTGTTGAGCACGTTAACA
ATGTGGCTGGGGCGGATGAAGCTAATGCAACACGTGGTTGATTCCAGACCCTCCTTCCacttgcagcttttgcagcttgttctgcacctgctgaagttgc
agtAACAGCTCAAGGTCCGCGCGGAAACTCGATCCAccgcaacagcttcatgtCACCGGAGGAAAATCAGTCGGGAAATGTTGCTGCCTGTGCTGTTCCT
GAGCCTTTAAGCTCCATCCTGGACTCCATTCACTTCTGAATAGAGTCAACAGTCGCGACTATTGATCTTGTCCCCTTTGGTCCCATATCTACGATGCAGC
TTCATCCTGGGAGTTTGCtcttggtggtgctggcactgcaATGCTGCACGTTCTCGGGTGGAGAGCACTTGTCCGCCCAAGCGAGAGATTTGGGCAATGA
GTATCCGTCGTCGGTGTCACTGTGCGGGGAGAATCTCGCCAAGGAGACCGGGACACTCAACGGTCTCTACTACGTCTACTATGAGTCGACCGCCACGAAA
GCTGACGTTCCTATGATTTTGTGGCTCTCTGGTGGTCCTGGGTGCTCTGGCTTGGTCGCCTTGCTGTTCGAGAATGGTCCTTGCTCATTTGACGATGAGA
CGGACAAGGTGTCGTTCAATCCGTACTCGTGGACTGGACTCGCTCATGTTATTTACCTTGACCAGCCCAAAGGCACAGGATTTAGTGACGGGGACAACGG
AATCATGCAGCCTTGGACACTTGGAGGTGCCACAGACGACATGCACGGGTTTCTCCGGGACTTTTACCTGCTACATCCACAGCTGAGAGTGCGTGACTTC
TACATATTCGGAGAGAGCTACGCTGGACACTACGTACCTGACTTAGCGGTGAGAATGCTCGACAGCAATGCATCCTTTCCAACGTTGAAAGGCATCGCAA
TTGGGAACGGAGTTGTGTCGACCAAAGCTTGGATCGCGTCGGCGATGCCGTTCTTGAAATACAATAGCTATGGATACGACTTCCTTGGTTCGAATGAACA
ATTGCTGCAAACATATCGCGATCGATTCATGTCTGCGCTTGCAAACTGCAACCGAAGAAATCACCTTCGTCATTCGTCTTCTGAGGGTGTCAGCAACGAA
TGCGATGACGCGTTCCAAAGCCTCACGGACTTCAGTGGAATGGTTAGCTCCACCGTCGAGGGCCTTGGTCGGAACGTATATGACATTCGTCGCGAATGTC
ATTGTGACGACCCCATTCGTCTCTGCTACCGCTTCTCCCGTCTCCAAACTTTCGTCAACAGTCCCGGGGCAAGCGCGTACTTCGGTGAAACTCCTCACAA
GTGGCAGCTCTGTGCATCTGGAGCTCTTCCAGAATTGGCGGTCACGGACAAACTGGAAGAAAGTGAGGCCAACGTCGCTCGGGCACTGGAACACGGCGTT
CGGGTTCTCGTCTACGGCGGTGACGCTGACACCGTCGCCAATTGGATGACACAAGACGCTTGGACTCGCGATCTCTCTTGGAAACACCAGGCAGAGTTCA
CTTGTGCTTCCTTCGCCGAACAAATCTTCCAAGGCCAACCAATCGGTCGCGTCCGCACTTCACACGGCTTCAGTTTCATGAAAATCTACAACGCAGGCCA
CGTACGTGCATCCCTAATGTTTGCACCCCTGTATCTTCTCCACTAACTTTGCTTTCTCTCTTGTTGTAGATGGTTCCCCACGACCAACCCGCCAACTCGT
ACGAAATTGCCCGCAGCTTCATCTACGACGTTCCAGGTGTCGGTCTGTTCAGCTAGGTAGAGTTCAACAAATCCCCACCTCGGCACAAAACCATCTACCA
TACTAAACATGCACTTTAGAATTACCAAAAACTAATTAAACCTCCCTCAGCTCTTGTCCCCATCCGTCTACCGTTGCTCCTGGTTGCACGACAGGCAGAA
GACGCGGTCGAACTGCTCGTCGCAGTTCAGCGTCGAGCACAGCGAGCAGAAGACATTGCAGCACGCGTCACACTCGCGACGGCAGCAGTCGCCCATCTTC
CTCTCGCAGTGGGAGCAGCTCTGCATTGCCTTGGCCTGGAAGTGGCGCTTGGCTTGTTTCCCCGCGCTCTCGCACACATTGCAGCATTGCAGCGACGAAA
TGTCCGCTTTCCTGCCGCCAAAGAGCTTcccgatgctgctgtgcttcTTGATACGCGCGTTGGTGACGGCTGCCGACATCATGCGACTCAGTGCGTCTGA
AATCAGCAGTAAAAGGTGAGGTTTAACGCTAAAAAGTAGCTTGCAAGAGGGGAAAATGACGCACCGACGGGCACGGAGCGGTCTCGGCAGCGCTTAGCGG
ACGCGTGCGGCGGCTTCCAGGGCGACATGGAGGCCCAGAGAGCcgacggaggtggcgtcATCCCCACCGCGTCCATGTCGCAGTCCTCCGTCAGGCTCTC
GTCACGCGAACGCTTCATGGCTGTAGTCGTGAATtaggagctgctggccgcgcGCTAAAACGGAAGTGAGATACAAGTGATGGCGGGAAGCAAATTGGCG
CCGATTCGGTAAAGTACGATATGGTGTGAGCGCTCTCCCAAATACAAAAAACAAGTGAAAAAATCGATGCTATTGAAAAACTCAGTGCTTCCAGCTGGCA
GATAGGCACACAAACGAGGGAAAGGGAGTTAGTGACAGTAcaacgacagcttcaacagcaacagagtCAACTTACATCTTGATGGTGCGGTCCTTGCTGC
CTGACGCCACCATGTCGCCGTTGGGGCTCCAGTCCAGCGCGTACACCTCGTCAGCATGGCCCGACAGTGTCGTCTTGGCGTTCTTTGGAGCACTGAGCTC
CCACACTTTCACGGTCGAGTCCTTGCTGGCTGTCACGATCAGGCGTGCATCACTCGACCAGCACACCTGGTACACGGCGCCGACGTGGCCCGTGAGCGTG
GCAATGAACTTGCCGGTCTGGCCGTTCCAGATCTTGACCTTCTTGTCGAAACTGGCACTGGCGAAGTATCGTCCGTCCGGTGAGAAACTCAGGTGGTtca
cgggctgctggtggcctGTGAGGCGAGCCAGCGGCTTCTTGCTCTCCGATGGCTCCCAAAAGAATAGCGTGAAATCGTCCGAGCCGGAGACCAAACGCTC
CGGTTGTCCCTTACGCACCTCCTGATACCGcttcagcgccgcctcctgcatctcctcaCGCGACGCGAAGCTCTTCGTGCTGTGGCCGAACGGACCCGAA
CGACAAACGTAGTCCACATTCAGCGCCAACGTGTTGATACGGTGACCGTGTCCGATCAATGTACGCACGAGCTTGCCCACGTGCTCGCCCTCCATCGCCC
AAACCTTGATGGTACGGTCACGGGACGCACTGTACAGCAAACCTTCGCCTCCCCATTTGATGCACTCCACCGAGTCTGTGTGGCCAGACAATGAAGCAAT
GGATCGACCTGTACGAGCGTTCCATACCTTAATCGATCCGTCCTTCGAAGAACTCGCGAATCGCTCACAAGTGGCGTTACGATGCATCGGCTCCCACGTC
AACGAGTTCACCCACTGCTTGTGTCCTTTCATGGGCTGGCCGATCTGCTTACCCGTCAGCGGGTCCCACAAGCGAATCTCACCATTACGGTCCGCCGACG
CAAAGCGCGCTCCATCCGGCGACCACGCCGTACACAGCACGTGGTTCTTGTGTCCTCGTCCTGTGTGTTTCGGCATGCAAGTGTTGGTGTCCCAGA